ORFeome > MGC64596 ORF1 – XORFeome v1.0

MGC64596 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255496
Gene Page ID:
ORF Xenbase ID: 17258559

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC054320
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ839130
dbEST ID: 79656832
Trimmed Sequence: ATGGCACCAAGAAAATCCACTAGACAAGACAAGAAACCAAAAAGGACTCCTCCTGTGCTTACTCCTGAACAAAAAAAGAAAAGAGCCTTTCAGAGAGCGCAGCTAGAGGAAGAAATGAAGATAATGTCATCTGGCAACCATGCTGACAATTGTCTTTTATATGAACCCGTGCTTCGAGAAAGAGCACAAAGACAATCATGTCAACCGCCTGCTACAGTAAGAGTTGGAAACACAAACTGGTGTGTATGTGGCCACTGTTGCCCAATGCCCACAGAAGAGGAATCCATTTGCTGCATGGAGATAGAAAACCTACAGGGCATTGTTACAGAAGACATTACGTGTATAACGGAACATCCCCAATTTGATGAATACTGTCAAAATAAAAGTAATTTGAAAATGTGCCTTTTGTTTTCTGGCAAATGGCGTACTCAAAGAACACCTGAACATAATAGGGAGTTTAGAAAAGCTGCCTATCGCCTGTTTACTAGGTGGATCCATGGATTTCTAGGACCGAAGCACCGCCGGCCCATACCATCCTGTGTTGTCCGTAAAGTCCGTAATATTTTTCTTGAACATAATAATCGCTATACAGGATTTTATGTTTCCTCTGACTACTGTGCTGCTGATATGGCAAATGAGTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACCAAGAAAATCCACTAGACAAGACAAGAAACCAAAAAGGACTCCTCCTGTGCTTACTCCTGAACAAAAAAAGAAAAGAGCCTTTCAGAGAGCGCAGCTAGAGGAAGAAATGAAGATAATGTCATCTGGCAACCATGCTGACAATTGTCTTTTATATGAACCCGTGCTTCGAGAAAGAGCACAAAGACAATCATGTCAACCGCCTGCTACAGTAAGAGTTGGAAACACAAACTGGTGTGTATGTGGCCACTGTTGCCCAATGCCCACAGAAGAGGAATCCATTTGCTGCATGGAGATAGAAAACCTACAGGGCATTGTTACAGAAGACATTACGTGTATAACGGAACATCCCCAATTTGATGAATACTGTCAAAATAAAAGTAATTTGAAAATGTGCCTTTTGTTTTCTGGCAAATGGCGTACTCAAAGAACACCTGAACATAATAGGGAGTTTAGAAAAGCTGCCTATCGCCTGTTTACTAGGTGGATCCATGGATTTCTAGGACCGAAGCACCGCCGGCCCATACCATCCTGTGTTGTCCGTAAAGTCCGTAATATTTTTCTTGAACATAATAATCGCTATACAGGATTTTATGTTTCCTCTGACTACTGTGCTGCTGATATGGCAAATGAGTTGCCAACTTTCTTGTTACAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGGCACGAAAGGGTCATTATCGTTCAAATAAATTCATTATTTGCCATCCCCGGCTTAATTCCCCCTATAGTGAAAAAAAAAAAAAAAAAAAAAAAACTGGTTTTCCTGGGGACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACCAAGAAAATCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839129
dbEST ID: 79656831
Trimmed Sequence: CTCATCTGCCATATCAGCAGCACAGTAGTCAGAGGAAACATAAAATCCTGTATAGCGATTATTATGTTCAAGAAAAATATTACGGACTTTACGGACAACACAGGATGGTATGGGCCGGCGGTGCTTCGGTCCTAGAAATCCATGGATCCACCTAGTAAACAGGCGATAGGCAGCTTTTCTAAACTCCCTATTATGTTCAGGTGTTCTTTGAGTACGCCATTTGCCAGAAAACAAAAGGCACATTTTCAAATTACTTTTATTTTGACAGTATTCATCAAATTGGGGATGTTCCGTTATACACGTAATGTCTTCTGTAACAATGCCCTGTAGGTTTTCTATCTCCATGCAGCAAATGGATTCCTCTTCTGTGGGCATTGGGCAACAGTGGCCACATACACACCAGTTTGTGTTTCCAACTCTTACTGTAGCAGGCGGTTGACATGATTGTCTTTGTGCTCTTTCTCGAAGCACGGGTTCATATAAAAGACAATTGTCAGCATGGTTGCCAGATGACATTATCTTCATTTCTTCCTCTAGCTGCGCTCTCTGAAAGGCTCTTTTTCTTTTTTGTTCAGGAGTAAGCACAGGAGGAGTCCTTTTGGGTTTCCTGTCCTGTCAAGTGGAATTTCTTGGGTGCCAGGGTGGCAACCTTTTTTGTACCAAGTTTGGGAATTATAAAAAAGCCTTGGTTCTATCAATTTTTGTTGGCACCAAAACAGGGTCAAAAATAAATCC
Full Trace Sequence: GGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCATCTGCCATATCAGCAGCACAGTAGTCAGAGGAAACATAAAATCCTGTATAGCGATTATTATGTTCAAGAAAAATATTACGGACTTTACGGACAACACAGGATGGTATGGGCCGGCGGTGCTTCGGTCCTAGAAATCCATGGATCCACCTAGTAAACAGGCGATAGGCAGCTTTTCTAAACTCCCTATTATGTTCAGGTGTTCTTTGAGTACGCCATTTGCCAGAAAACAAAAGGCACATTTTCAAATTACTTTTATTTTGACAGTATTCATCAAATTGGGGATGTTCCGTTATACACGTAATGTCTTCTGTAACAATGCCCTGTAGGTTTTCTATCTCCATGCAGCAAATGGATTCCTCTTCTGTGGGCATTGGGCAACAGTGGCCACATACACACCAGTTTGTGTTTCCAACTCTTACTGTAGCAGGCGGTTGACATGATTGTCTTTGTGCTCTTTCTCGAAGCACGGGTTCATATAAAAGACAATTGTCAGCATGGTTGCCAGATGACATTATCTTCATTTCTTCCTCTAGCTGCGCTCTCTGAAAGGCTCTTTTTCTTTTTTGTTCAGGAGTAAGCACAGGAGGAGTCCTTTTGGGTTTCCTGTCCTGTCAAGTGGAATTTCTTGGGTGCCAGGGTGGCAACCTTTTTTGTACCAAGTTTGGGAATTATAAAAAAGCCTTGGTTCTATCAATTTTTGTTGGCACCAAAACAGGGTCAAAAATAAATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCATCTGCCATATCAGCAGCAC