ORFeome > MGC68452 ORF1 – XORFeome v1.0

MGC68452 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254650
Gene Page ID:
ORF Xenbase ID: 17258565

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC061932
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ824811
dbEST ID: 79642513
Trimmed Sequence: ATGTTGCTCCCAGTGGCCTCAAAGCAGACCCCCAAGGGAACCTGTCTGGAGGCAGTAAAACTGGCCATAGATCTTGGCTACCGACACTTTGATGGGGCTTATGTATACTACAATGAACATGAGGTGGGTCAGGCCATCAGGGAGAAGATCGCTGAGGGAAACGTCAAACGAGAAGACATTTATTACTGTGGCAAACTTTGGAACACATGCCATCCGCCTGAACTTGTGCGGCCGACATTGGAGAAGACGCTAAAAACCCTCCAGCTGGATTACGTGGACCTGTATATCATCGAGCTGCCCATGGCTTTCAAGCCTGGGGATGAAATTTACCCACGGGACACAAATGGAAAGTTTCTGTATCACAAGACAGATCTGTGTGCAACGTGGGAGGCGCTGGAAGAGTGCAAAGACGCAGGGCTGGTCAAATCCATTGGCGTCTCCAACTTTAACCGCCGGCAGCTGGAGCTGATTCTCAATAAACCAGGACTGAAATACAAACCTGCCACAAACCAGGTTGAATGTCACCCATATTTCACCCAACCGAAATTGCTGGAGTTCTCCAAACAACATAAAATTGTGACTGTAGGCTACAGTCCTATTGGAACCTGCCGTGATGAAACATGGGTCAATGTGTCTTCCCCTCCTCTCTTGGAAGATCCTCTCCTGAATTCATCAGNCAGAATACAACAGACAGCAGCCCAGGTAGCTCTGCGCTTTCATGCCAGGAGGGGAGTCGTGGTCATTTCAAAAAGTTTTAACCAAGACGGAATCAACGAAAACCTTTCAGAATTTTTTGACCTCCAGTCTGACGGAAAAAGGAAAAATAAAA
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGCTCCCAGTGGCCTCAAAGCAGACCCCCAAGGGAACCTGTCTGGAGGCAGTAAAACTGGCCATAGATCTTGGCTACCGACACTTTGATGGGGCTTATGTATACTACAATGAACATGAGGTGGGTCAGGCCATCAGGGAGAAGATCGCTGAGGGAAACGTCAAACGAGAAGACATTTATTACTGTGGCAAACTTTGGAACACATGCCATCCGCCTGAACTTGTGCGGCCGACATTGGAGAAGACGCTAAAAACCCTCCAGCTGGATTACGTGGACCTGTATATCATCGAGCTGCCCATGGCTTTCAAGCCTGGGGATGAAATTTACCCACGGGACACAAATGGAAAGTTTCTGTATCACAAGACAGATCTGTGTGCAACGTGGGAGGCGCTGGAAGAGTGCAAAGACGCAGGGCTGGTCAAATCCATTGGCGTCTCCAACTTTAACCGCCGGCAGCTGGAGCTGATTCTCAATAAACCAGGACTGAAATACAAACCTGCCACAAACCAGGTTGAATGTCACCCATATTTCACCCAACCGAAATTGCTGGAGTTCTCCAAACAACATAAAATTGTGACTGTAGGCTACAGTCCTATTGGAACCTGCCGTGATGAAACATGGGTCAATGTGTCTTCCCCTCCTCTCTTGGAAGATCCTCTCCTGAATTCATCAGNCAGAATACAACAGACAGCAGCCCAGGTAGCTCTGCGCTTTCATGCCAGGAGGGGAGTCGTGGTCATTTCAAAAAGTTTTAACCAAGACGGAATCAACGAAAACCTTTCAGAATTTTTTGACCTCCAGTCTGACGGAAAAAGGAAAAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCTCCCAGTGGCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ830182
dbEST ID: 79647884
Trimmed Sequence: GTATTCATCCTTGAAGGGGTATTCTGGGTGGTCGCTCCACATTAACAACTCCACATAGCGAACATTCTTGTTCAAAGTCTCAATGTCCTTCATCTCCTTGTCCGTCAAACTGAAGTCAAAAATCTGAAAGTTTTCGTTGATTCTGTCTGGGTTAAAACTTTTTGGAATGACCACAACTCCCCTCTGGGCATTGAAGCGCAAAGCTACCTGGGCTGCTGTCTTGTTGTATTTCTTGCTGATGGAATTCAGGAAAGGATCTTCCAAAAAAGGAGGGGAAAACACATTGACCCATGTTTCATCACGGCAGGTTCCAATAGGACTGTAGCCTACAGTCACAATTTTATGTTGTTTGGAGAACTCCAGCAATTTCGGTTGGGTGAAATATGGGTGACATTCAACCTGGTTTGTGGCAGGTTTGTATTTCAGTCCTGGTTTATTGAGAATCAGCTCCAGCTGCCGGCGGTTAAAGTTGGAGACGCCAATGAATTTGACCAGCCCTGCGTCTTTGCACTCTTCCAGCGCCTCCCACGTTGCACACAGATCTGTCTTGTGATACAGAAACTTTCCATTTGTGTCCGGTGGGTAAAATTCATCCCCAGGCTTTGAAGCCATGGGCAGCTCGATAAAATACAGGTCCACTTAACCAGCCTGGAGGGTTTTTAGCGTTCTTCTCCATGGCGGCCGCACAATTTCAGGGGGAAGGGCAGGTGTCCCAAAATTTGCCCAAAATTAATAAAAGGTCCTTTCCCCCTTTTGAAAGTTTCCCC
Full Trace Sequence: TGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCTTGAAGGGGTATTCTGGGTGGTCGCTCCACATTAACAACTCCACATAGCGAACATTCTTGTTCAAAGTCTCAATGTCCTTCATCTCCTTGTCCGTCAAACTGAAGTCAAAAATCTGAAAGTTTTCGTTGATTCTGTCTGGGTTAAAACTTTTTGGAATGACCACAACTCCCCTCTGGGCATTGAAGCGCAAAGCTACCTGGGCTGCTGTCTTGTTGTATTTCTTGCTGATGGAATTCAGGAAAGGATCTTCCAAAAAAGGAGGGGAAAACACATTGACCCATGTTTCATCACGGCAGGTTCCAATAGGACTGTAGCCTACAGTCACAATTTTATGTTGTTTGGAGAACTCCAGCAATTTCGGTTGGGTGAAATATGGGTGACATTCAACCTGGTTTGTGGCAGGTTTGTATTTCAGTCCTGGTTTATTGAGAATCAGCTCCAGCTGCCGGCGGTTAAAGTTGGAGACGCCAATGAATTTGACCAGCCCTGCGTCTTTGCACTCTTCCAGCGCCTCCCACGTTGCACACAGATCTGTCTTGTGATACAGAAACTTTCCATTTGTGTCCGGTGGGTAAAATTCATCCCCAGGCTTTGAAGCCATGGGCAGCTCGATAAAATACAGGTCCACTTAACCAGCCTGGAGGGTTTTTAGCGTTCTTCTCCATGGCGGCCGCACAATTTCAGGGGGAAGGGCAGGTGTCCCAAAATTTGCCCAAAATTAATAAAAGGTCCTTTCCCCCTTTTGAAAGTTTCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCTTGAAGGGGT