ORFeome > MGC68519 ORF1 – XORFeome v1.0

MGC68519 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5807252
Gene Page ID: 5807236
ORF Xenbase ID: 17258649

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061680
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ824784
dbEST ID: 79642486
Trimmed Sequence: ATGTGGCTCCTATTGCTGGGGGTGGCGGCGGCACTGATCTTCCTGTATAGATGGAACAGACAGAAACAGACACTCGAGAATCTCACAAATAAATATGTGCTGATCACCGGCTGTGACTCTGGATTTGGGAACCTTGCAGCAAAGCAACTGGATGCTCGAGGACTGAAGGTGCTGGCAGCTTGTCTAACAGAGAAGGGAGCTGAGGAGTTGAAGAAAGAGACATCCAGCAGACTCAAAACTGTCATTGTGGATGTTAGTGACAGCGAGAGTGTTAGCAAGGCTGCTGAATGGGCTTCTCAGATTGTTGGAAATGCAGGACTCTGGGGTTTGGTAAATAATGCAGGAATTGGCCTTCCCGTTGGACCTAATGCTTGGATGAAGAAAGAACACTTTGTCAAGGTGATCGATATAAATTTGCTGGGTACCGTCGATGTGACACTTAAACTGCTGCCTCTTATCAGAAAAGCAAAGGGACGAATTGTGAATGTCGCCAGCATTATGGGAAGGATTTCTCTTTTGGGGGGAGGTTACTGCCTCTCCAAATATNGGTGTGGAGGCCTTCTCGGACAGCCTAAGGAGGGAGCTTTCCTGCTTCGGCATAAAGGTTTCTATTATTGAGCCAGGAGGTTTCAATACTTCCATTATAAATGCCAAATGCATGTAAGAAGAGTATAGAACAGCTTTGGGACAATCTGCCAGCTGAGACCNANNGAAGCTACGGAGAACAGTACTTACATGAGACTTTACGGAAAATCGAAGAGCTGATTAAGGGCAACAGCCCCAAGCTCTACCGGGGTCACAAAACGGTATGGGAAGCAGGGCCCTCACCGGGCTGT
Full Trace Sequence: TAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCCTATTGCTGGGGGTGGCGGCGGCACTGATCTTCCTGTATAGATGGAACAGACAGAAACAGACACTCGAGAATCTCACAAATAAATATGTGCTGATCACCGGCTGTGACTCTGGATTTGGGAACCTTGCAGCAAAGCAACTGGATGCTCGAGGACTGAAGGTGCTGGCAGCTTGTCTAACAGAGAAGGGAGCTGAGGAGTTGAAGAAAGAGACATCCAGCAGACTCAAAACTGTCATTGTGGATGTTAGTGACAGCGAGAGTGTTAGCAAGGCTGCTGAATGGGCTTCTCAGATTGTTGGAAATGCAGGACTCTGGGGTTTGGTAAATAATGCAGGAATTGGCCTTCCCGTTGGACCTAATGCTTGGATGAAGAAAGAACACTTTGTCAAGGTGATCGATATAAATTTGCTGGGTACCGTCGATGTGACACTTAAACTGCTGCCTCTTATCAGAAAAGCAAAGGGACGAATTGTGAATGTCGCCAGCATTATGGGAAGGATTTCTCTTTTGGGGGGAGGTTACTGCCTCTCCAAATATNGGTGTGGAGGCCTTCTCGGACAGCCTAAGGAGGGAGCTTTCCTGCTTCGGCATAAAGGTTTCTATTATTGAGCCAGGAGGTTTCAATACTTCCATTATAAATGCCAAATGCATGTAAGAAGAGTATAGAACAGCTTTGGGACAATCTGCCAGCTGAGACCNANNGAAGCTACGGAGAACAGTACTTACATGAGACTTTACGGAAAATCGAAGAGCTGATTAAGGGCAACAGCCCCAAGCTCTACCGGGGTCACAAAACGGTATGGGAAGCAGGGCCCTCACCGGGCTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCCTATTGCTGGGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830152
dbEST ID: 79647854
Trimmed Sequence: TGCTGCTCCTTTGGGTGGGCTGGGTGCTAGCCTGGATGCCACGTAGTCCGCTAAGAAGGTTGGAAGGTAGGAAAGCGGGAGGTAGAATAACTTTGCATCCCATCCAGGAGAATAGCGGGTCCATGGGTGACAAGCAGTGAGTGCATGCTCCATACAGTTTGTGACCCTGTAGAGCTTGGGGCTGTTGGCCTTAATCAGCTCTTCGATTTTCTGTAAAGTCTCATGTAAGTACTGTTCTCCGTAGCTTTCCTTGGTCTCAGCTGGCAGATTGTCCCAAAGCTGTTCTATACTCTTCTTACATGCATTGGCATTTATAATGGAAGTATTGAAACCTCCTGGCTCAATAATAGAAACCTTTATGCCGAAGCAGGAAAGCTCCCTCCTTAGGCTGTCCGAGAAGGCCTCCACACCATATTTGGAGAGGCAGTAACCTCCCCCCAAAAGAGAAATCCTTCCCATAATGCTGGCGACATTCACAATTCGTCCCTTTGCTTTTCTGATAAGAGGCAGCAGTTTAAGTGTCACATCGACGGTACCCAGCAAATTTATATCGATCACCTTGACAAAGTGTTCTTTCTTCATCCAAGCATTAGGTCCAACGGGGAAGGCCAATTCCCGCATTATTTTACCAACCCCAAGAGTCCTGCATTTCCCACAATCTGAGAAAGCCATTCAGCAGCCTTGCTAACACTCTCGCTGTCACTAACATCAACAAATGACAGTTTTTGAGTCCTGCTGGGAAGTTCCCTTTTCTTTCAACTCCTTCCAACCTTCCCT
Full Trace Sequence: AGGGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTGCTCCTTTGGGTGGGCTGGGTGCTAGCCTGGATGCCACGTAGTCCGCTAAGAAGGTTGGAAGGTAGGAAAGCGGGAGGTAGAATAACTTTGCATCCCATCCAGGAGAATAGCGGGTCCATGGGTGACAAGCAGTGAGTGCATGCTCCATACAGTTTGTGACCCTGTAGAGCTTGGGGCTGTTGGCCTTAATCAGCTCTTCGATTTTCTGTAAAGTCTCATGTAAGTACTGTTCTCCGTAGCTTTCCTTGGTCTCAGCTGGCAGATTGTCCCAAAGCTGTTCTATACTCTTCTTACATGCATTGGCATTTATAATGGAAGTATTGAAACCTCCTGGCTCAATAATAGAAACCTTTATGCCGAAGCAGGAAAGCTCCCTCCTTAGGCTGTCCGAGAAGGCCTCCACACCATATTTGGAGAGGCAGTAACCTCCCCCCAAAAGAGAAATCCTTCCCATAATGCTGGCGACATTCACAATTCGTCCCTTTGCTTTTCTGATAAGAGGCAGCAGTTTAAGTGTCACATCGACGGTACCCAGCAAATTTATATCGATCACCTTGACAAAGTGTTCTTTCTTCATCCAAGCATTAGGTCCAACGGGGAAGGCCAATTCCCGCATTATTTTACCAACCCCAAGAGTCCTGCATTTCCCACAATCTGAGAAAGCCATTCAGCAGCCTTGCTAACACTCTCGCTGTCACTAACATCAACAAATGACAGTTTTTGAGTCCTGCTGGGAAGTTCCCTTTTCTTTCAACTCCTTCCAACCTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTGCTCCTTTGGGTGGGCT