ORFeome > MGC68521 ORF1 – XORFeome v1.0

MGC68521 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254921
Gene Page ID:
ORF Xenbase ID: 17258655

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060454
Original XGC clone length: 1206

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ824756
dbEST ID: 79642458
Trimmed Sequence: ATGACAACTGCTGGGATTTCAACACAAGAAACCCAGGTCCCATTGAAACATGGGTTTGTGCACAGTGGACAGGGAATAATCAGTTCCAATTCATGCTGGACGAATCCTGGTAATTTTGAAAATGCATACTCTCTAACCTGTAGTTTAAGGGCACCTACTCAGCATATATCAGCCATTGGCCACATTTCAAAGCCAATAATGAACGGACATTGCTATTCTGAAAATTGCATGAATGTACATTTGAAAAAACCAGGGTTTCTTCACCTTGTAGAGGATTTATCTACAAACTATGCAGAAGATCATATTGTTTCTTCCTTAAAAAAACTATCCATGAACAGTGGATCTGGTAATGAAAAAACACCTCCACTTACACCTGTCAAAAGTGGACCACCACAGTTTTCTGCCATCTCTTCACACGATCGAAGTTCAAGGCCGCTTCCTCCTCTTCCAATATCAGAGGATTGTTATTTCGATGATGCAGACAGTGAGGTAGAATTCTTCACAAGTTCTGATACAGACTTGCTTTTACAAGATAATAGACCATTAGCCTTTAAGTATGGAGTTCCCAGTAGGCGAAGCTTCAGGGGATGTGGACAAATGAACTATGCCTATTGTGATCCGCCATCTGTAAATAAACCAGCAGACGAGAGTCCAACATCTAACCAAAATGGACGTATACACAGCTCAAAACCTCAGAAATCTGAGCAAAGCCATAGGAAGCTACGGCGATCTCATTCANGACCAGCTGGATCTTTACATAAACCTGCAATTCGTAATAGAAAGCCTTATTAATAGGAACTTTCCCCCATTTCTTGATGAAAAAAAAAACCTGAA
Full Trace Sequence: ACAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAACTGCTGGGATTTCAACACAAGAAACCCAGGTCCCATTGAAACATGGGTTTGTGCACAGTGGACAGGGAATAATCAGTTCCAATTCATGCTGGACGAATCCTGGTAATTTTGAAAATGCATACTCTCTAACCTGTAGTTTAAGGGCACCTACTCAGCATATATCAGCCATTGGCCACATTTCAAAGCCAATAATGAACGGACATTGCTATTCTGAAAATTGCATGAATGTACATTTGAAAAAACCAGGGTTTCTTCACCTTGTAGAGGATTTATCTACAAACTATGCAGAAGATCATATTGTTTCTTCCTTAAAAAAACTATCCATGAACAGTGGATCTGGTAATGAAAAAACACCTCCACTTACACCTGTCAAAAGTGGACCACCACAGTTTTCTGCCATCTCTTCACACGATCGAAGTTCAAGGCCGCTTCCTCCTCTTCCAATATCAGAGGATTGTTATTTCGATGATGCAGACAGTGAGGTAGAATTCTTCACAAGTTCTGATACAGACTTGCTTTTACAAGATAATAGACCATTAGCCTTTAAGTATGGAGTTCCCAGTAGGCGAAGCTTCAGGGGATGTGGACAAATGAACTATGCCTATTGTGATCCGCCATCTGTAAATAAACCAGCAGACGAGAGTCCAACATCTAACCAAAATGGACGTATACACAGCTCAAAACCTCAGAAATCTGAGCAAAGCCATAGGAAGCTACGGCGATCTCATTCANGACCAGCTGGATCTTTACATAAACCTGCAATTCGTAATAGAAAGCCTTATTAATAGGAACTTTCCCCCATTTCTTGATGAAAAAAAAAACCTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAACTGCTGGGATTTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830110
dbEST ID: 79647812
Trimmed Sequence: TATCTGCTCCACTAAGCAGGATGTCTCTGGAAGAAGATAATAATGTGTAGAACTGGCCTTCTCACCATTTTCAATAATGGGCAAAATACAAGGGATTTTATTGGCTGATCCCTCACTATATTGCCTTTGATAAGTTTTGCTACTGACATATTTTGGATCAGGAGCAAAGCTCTGTGTTGGGGGCATTATCCCATAGAGGTACGATGGTAGACTTTTTGGGCTTGGGGTACGAGAGTTACTTCTTGACAGAGGTTCCCTTGGTGGCAGTTTAGGTGGTTTATCTTCATCACTGTATGTGTTTGAAGAAACTTCTGCCGACCACCGCCTGTAATCAGGTTTTAGTGACCTGGGAGGTATGGGAATCCTTGGTGGAACTTCAGGTTTTTCTTCATCAGAATTAGGGGAAGTCCTATTTATATGGCTTCCTATACGAATTGCAGGTTTATTGTAAGATCCAGCTGGTCCTGAATGAGATCGCCGTAGCTTCCTATGGCTTTGCTCAGATTTCTGAGGTTTTGAGCTGTGTATACGTCCATTTTGGTTAGATGTTGGACTCTCGTCTGCTGGTTTATTTACAGATGGCGGATCACAATAGGCATAGTTCATTTGTCCACATCCCCTGAAGCTTCGCCTACTGGGGACTCCATACTTAAAGGGCTATGGGTCTATTATCTTGTAAAAGCAAGTCTGTATCAGAACTTGGTGAAAAATTCTACCTCCCTGTCTGCCTCAATCAAAATAACAATTCCTTCTAAAATTTGGAAAAAAAA
Full Trace Sequence: CAGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATCTGCTCCACTAAGCAGGATGTCTCTGGAAGAAGATAATAATGTGTAGAACTGGCCTTCTCACCATTTTCAATAATGGGCAAAATACAAGGGATTTTATTGGCTGATCCCTCACTATATTGCCTTTGATAAGTTTTGCTACTGACATATTTTGGATCAGGAGCAAAGCTCTGTGTTGGGGGCATTATCCCATAGAGGTACGATGGTAGACTTTTTGGGCTTGGGGTACGAGAGTTACTTCTTGACAGAGGTTCCCTTGGTGGCAGTTTAGGTGGTTTATCTTCATCACTGTATGTGTTTGAAGAAACTTCTGCCGACCACCGCCTGTAATCAGGTTTTAGTGACCTGGGAGGTATGGGAATCCTTGGTGGAACTTCAGGTTTTTCTTCATCAGAATTAGGGGAAGTCCTATTTATATGGCTTCCTATACGAATTGCAGGTTTATTGTAAGATCCAGCTGGTCCTGAATGAGATCGCCGTAGCTTCCTATGGCTTTGCTCAGATTTCTGAGGTTTTGAGCTGTGTATACGTCCATTTTGGTTAGATGTTGGACTCTCGTCTGCTGGTTTATTTACAGATGGCGGATCACAATAGGCATAGTTCATTTGTCCACATCCCCTGAAGCTTCGCCTACTGGGGACTCCATACTTAAAGGGCTATGGGTCTATTATCTTGTAAAAGCAAGTCTGTATCAGAACTTGGTGAAAAATTCTACCTCCCTGTCTGCCTCAATCAAAATAACAATTCCTTCTAAAATTTGGAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATCTGCTCCACTAAGCAGGATG