ORFeome > MGC68910 ORF2 – XORFeome v1.0

MGC68910 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255482
Gene Page ID:
ORF Xenbase ID: 17258985

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108473
Original XGC clone length: 1092

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ837951
dbEST ID: 79655653
Trimmed Sequence: ATGTTGGGATTCCTAAGCCTTATGTTGATTCTCCTCCATGAGACAGGGTCTGCAGGAGCAGCATCACTATCAAGTTCTGAAGAAACATATGCTCTATCAGTCTGCGGTGCGCCAATGGTATCAGAACGGATAGTAGGGGGAACGGACAGTAAGAAGGGGGAATGGCCCTGGCAGATCAGTCTGAGCTACAAAGGGGAACCTGTCTGCGGGGGATCCCTTATTGCCAACAGCTGGATTCTGACTGCTGCTCACTGCTTTGATTCGCAAAACGTTTCCCAATATAAAGTTTACCTTGGGGTTTATCGATTGTCTCTCCTTCAAAATCCCAACACAGTCTCCAGGAGTGTGAAAAGAATCATCATACACCCAGATTACCAATTTGAAGGATCTAATGGGGACATTGCACTGATTGAAATGGATCAACCTGTCACCTTTACCCCTTACATTCTCCCAGCCTGCCTCCCACCCCCAGCTGCTCTGCTTCCTGCAGGGGTGAGATGCTGGGTGACTGGGTGGGGAGATATCAAAAAAGGACAACCTCTAGGTAACCCTTAAACCCTGCCAAAGGCTACAGTGAGTCTAATTGACTGGCATAGCTGTGAGTCCTTGTACAAAACCAACTTTGGATAACAAACTAAATTTCCTTTTTTCCTGGATTAACTTGGTCTTGGCTTGGTTAGGGGGAAAGAAAGGGGAAAGGCCTGTTCGGGGGAAACGTTGGAAGAAACCTTTTGGATGCCCAAAGTCAACAACACCATGAGGTGCCAAATCAGGGGGTGTGTTCCCCCCGGGGGGGTTATGTGGGGGGTTGGGAGCAGGACGTT
Full Trace Sequence: CCAGGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGGATTCCTAAGCCTTATGTTGATTCTCCTCCATGAGACAGGGTCTGCAGGAGCAGCATCACTATCAAGTTCTGAAGAAACATATGCTCTATCAGTCTGCGGTGCGCCAATGGTATCAGAACGGATAGTAGGGGGAACGGACAGTAAGAAGGGGGAATGGCCCTGGCAGATCAGTCTGAGCTACAAAGGGGAACCTGTCTGCGGGGGATCCCTTATTGCCAACAGCTGGATTCTGACTGCTGCTCACTGCTTTGATTCGCAAAACGTTTCCCAATATAAAGTTTACCTTGGGGTTTATCGATTGTCTCTCCTTCAAAATCCCAACACAGTCTCCAGGAGTGTGAAAAGAATCATCATACACCCAGATTACCAATTTGAAGGATCTAATGGGGACATTGCACTGATTGAAATGGATCAACCTGTCACCTTTACCCCTTACATTCTCCCAGCCTGCCTCCCACCCCCAGCTGCTCTGCTTCCTGCAGGGGTGAGATGCTGGGTGACTGGGTGGGGAGATATCAAAAAAGGACAACCTCTAGGTAACCCTTAAACCCTGCCAAAGGCTACAGTGAGTCTAATTGACTGGCATAGCTGTGAGTCCTTGTACAAAACCAACTTTGGATAACAAACTAAATTTCCTTTTTTCCTGGATTAACTTGGTCTTGGCTTGGTTAGGGGGAAAGAAAGGGGAAAGGCCTGTTCGGGGGAAACGTTGGAAGAAACCTTTTGGATGCCCAAAGTCAACAACACCATGAGGTGCCAAATCAGGGGGTGTGTTCCCCCCGGGGGGGTTATGTGGGGGGTTGGGAGCAGGACGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGGATTCCTAAGCCTTAT

Sequences - 3ʹ (reverse) EST

Accession: JZ837950
dbEST ID: 79655652
Trimmed Sequence: CCACAGGTGACTAAGACAGAAATACATAAGAGAAAGGGATATGGTTAGATGGGACCATGCCTGATTGTGAGCTCCACCACCTAAAGCCTTAACGAGTTCCAAACTTGCCCCACTGGAGTTGGTTGTTATATTTGTAGTCTCAAGAAACTCAACACTCCTGTTCATGGACTGTTCAAGGAGCTTTGTCATGTCTACAGCACTACTGGATGCTGATTTGTTGATTTGAACTGAAGTAATGTACTGCTTGATCCAAGCATCATAATACTGGACTTTGGTATAGACACCCGGTTGGTTAGCTTGTCCACATCCAATACCCCAGCTGACAATGCCGTATTGCCACCATGTGTTGTTGACTCTGCATACAAGAAGTCCTCCAGAGTCTCCCTGACAGGCGTCTACTTTTCCTTCCTTGTAGCCAGCACAGAACATGTCATCCAGGATAAAAGGAACATTAGGTTTGTATCCCAAGCTGGTTTCGTACATGGACTCACAGCTATGCCAGTCAATTAGACTCACTGTAGCCTTCTGCAGGGTTGTAGGGGTACCTAGAGGCTGTTCTTCTTTGATATCTCCCCACCCAGTCACCCCGCAATTCACCCCTGCCCGAAACAAGCAGCTTGGGGGTGGGAGGGGGGGCGGGAGAAAGGAAAGGGATAAAGGTAGAGGAATGGACCAATTCGATCATCGCCAGTGGCCAATTCACTTCCTCCAAATTGCGGATGCGGCGGTGTGGGGATGGGTGGGGGTGGCGGCCCTCCGTGGAA
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCACAGGTGACTAAGACAGAAATACATAAGAGAAAGGGATATGGTTAGATGGGACCATGCCTGATTGTGAGCTCCACCACCTAAAGCCTTAACGAGTTCCAAACTTGCCCCACTGGAGTTGGTTGTTATATTTGTAGTCTCAAGAAACTCAACACTCCTGTTCATGGACTGTTCAAGGAGCTTTGTCATGTCTACAGCACTACTGGATGCTGATTTGTTGATTTGAACTGAAGTAATGTACTGCTTGATCCAAGCATCATAATACTGGACTTTGGTATAGACACCCGGTTGGTTAGCTTGTCCACATCCAATACCCCAGCTGACAATGCCGTATTGCCACCATGTGTTGTTGACTCTGCATACAAGAAGTCCTCCAGAGTCTCCCTGACAGGCGTCTACTTTTCCTTCCTTGTAGCCAGCACAGAACATGTCATCCAGGATAAAAGGAACATTAGGTTTGTATCCCAAGCTGGTTTCGTACATGGACTCACAGCTATGCCAGTCAATTAGACTCACTGTAGCCTTCTGCAGGGTTGTAGGGGTACCTAGAGGCTGTTCTTCTTTGATATCTCCCCACCCAGTCACCCCGCAATTCACCCCTGCCCGAAACAAGCAGCTTGGGGGTGGGAGGGGGGGCGGGAGAAAGGAAAGGGATAAAGGTAGAGGAATGGACCAATTCGATCATCGCCAGTGGCCAATTCACTTCCTCCAAATTGCGGATGCGGCGGTGTGGGGATGGGTGGGGGTGGCGGCCCTCCGTGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACAGGTGACTAAGACAGA