ORFeome > MGC68961 ORF1 – XORFeome v1.0

MGC68961 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255184
Gene Page ID:
ORF Xenbase ID: 17259009

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057737
Original XGC clone length: 1887

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ824615
dbEST ID: 79642317
Trimmed Sequence: ATGGGGCGGCGATCCACTTCGTCCACCAAGAGTGGGAAATTCATGAATCCCACAGACCAAGCCCGGAAGGAGGCGAGGAAGCGGGAACTGAAAAAAAACAAGAAGCAAAGGATGATGGTTCGAGCAGCTGTTTTAAAAATGAAAGACCCAAAGCAGATTATCCGGGATATGGAGAAACTTGACGAGATGGAGTTCAATCCTGTTCAGCAACCCCAGCTCAATGAAAAAGTCCTGAAAGATAAACGTAAGAAACTCAAAGAGACATTTGAACGAATTCTCCATCTGTATGAGAAGGAGAACCCTGAAACGTACAAGGAGTTGCGCAAAGTAGAAATTGATTATGAGCACAAGCGATCTCAACTCAGCCAGTATTTTGATGCTGTTAAAAATGCTCAACATGTGGAGGTGGAAAGTATTCCATTGCCAGATCTGCCCCACGCACCCTCCAATATTCTCATTCAGGACATCCCACTGCCAGGAGCTCAGCCGCCCTCTATTCTTAAGAAGACCTCTGCCTATGGTCCTCCAGGTAGAGGAGTCTCCATGCCTTTTCCCCCAGGGCATGGAGTTCCACGTTTGCCCCCTGGAAAAAAACCTCCAGGGCCACCTCCCGGAACACCTCCCCCACAAGTTCTACAAATGTATGGGCGCAAGGTTGGCTTTGCTCTGGAAACATTAGAAAGGAAGGATGAGGAGGCAAGGTACGGCCCTGAATCAGGGCAAAGAGCCATCCTGACGGGACTAGCTTCCAGCGAAAATGAGGGGCTATCCCATTTAAAAAGGGACCGGAAAAAAAAATGAAAAAAGGCACCCCTGGATTGAAGAAAAAAGTGAA
Full Trace Sequence: TAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGCGGCGATCCACTTCGTCCACCAAGAGTGGGAAATTCATGAATCCCACAGACCAAGCCCGGAAGGAGGCGAGGAAGCGGGAACTGAAAAAAAACAAGAAGCAAAGGATGATGGTTCGAGCAGCTGTTTTAAAAATGAAAGACCCAAAGCAGATTATCCGGGATATGGAGAAACTTGACGAGATGGAGTTCAATCCTGTTCAGCAACCCCAGCTCAATGAAAAAGTCCTGAAAGATAAACGTAAGAAACTCAAAGAGACATTTGAACGAATTCTCCATCTGTATGAGAAGGAGAACCCTGAAACGTACAAGGAGTTGCGCAAAGTAGAAATTGATTATGAGCACAAGCGATCTCAACTCAGCCAGTATTTTGATGCTGTTAAAAATGCTCAACATGTGGAGGTGGAAAGTATTCCATTGCCAGATCTGCCCCACGCACCCTCCAATATTCTCATTCAGGACATCCCACTGCCAGGAGCTCAGCCGCCCTCTATTCTTAAGAAGACCTCTGCCTATGGTCCTCCAGGTAGAGGAGTCTCCATGCCTTTTCCCCCAGGGCATGGAGTTCCACGTTTGCCCCCTGGAAAAAAACCTCCAGGGCCACCTCCCGGAACACCTCCCCCACAAGTTCTACAAATGTATGGGCGCAAGGTTGGCTTTGCTCTGGAAACATTAGAAAGGAAGGATGAGGAGGCAAGGTACGGCCCTGAATCAGGGCAAAGAGCCATCCTGACGGGACTAGCTTCCAGCGAAAATGAGGGGCTATCCCATTTAAAAAGGGACCGGAAAAAAAAATGAAAAAAGGCACCCCTGGATTGAAGAAAAAAGTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGCGGCGATCCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ829965
dbEST ID: 79647667
Trimmed Sequence: AAGGAGACCTTCCATTTCTTTCATAAACGCTTCATACATATCGTCCTTGGTCTTCACTTGAATGTGTGCTCCAGTTTTAGGACCTGCTTTAGACACTGGTCTAACAACTTCCTCTTCTGGTTTCTTCGGCGTTGAAGCTGCCACTGAGCCTTTATTTTCTCTGCGAACACGGAGTGCAGTGGGCACAAAGCGCGTAACCTCAGCTTTGGGATTCGTGATCTGTGGTTTTGCGCTGATGGTGGCCGTTGCTTTCTTTTCAATAGTGGCTCCACTTTCGTCTGACTTGGGACGCTGTATTAAGCTTGGAGGGGCACTCAGCACCCCTGGGTTTGCAAGGGGTGCTGGAGGGAAAAGCCCTGGGGGAGCAGTGCCTGGAGGGGGTCCCAATGGAGGACGCATCATTGGACGGGGAGGCGGAGGCATACCTGGAGGTGCCGGTGGAGGTAGACGAGGAGGGGGTCCTCGAGGAGGTGGTCCTGGGGGCAAACCTGGTGGAGGACCTGGAGGAGGGCCAGGTGGACGGCCANGGGGGTGGTCCAGGCGGTAGCAGACCGTGGTGGTGGGCCCCGAAGTCCAGGAGGCCTTAGGAATGGAGGAGCACCTGGAGGTGGACCTGGAGGCATCCCAGATGGTGGTCCAGGTGGCCCTGTGGGGTGGGAAACTGGAGGAAGACCAAATTGGGCGGAGGTCCTGTTCATCATATTAGGTGGATGGGAAAAAGTGGGGAAGGGGGGGGGTAAAATAAAAAAAGGGTGGGTGGGAAAAAAAGTCCT
Full Trace Sequence: TGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGAGACCTTCCATTTCTTTCATAAACGCTTCATACATATCGTCCTTGGTCTTCACTTGAATGTGTGCTCCAGTTTTAGGACCTGCTTTAGACACTGGTCTAACAACTTCCTCTTCTGGTTTCTTCGGCGTTGAAGCTGCCACTGAGCCTTTATTTTCTCTGCGAACACGGAGTGCAGTGGGCACAAAGCGCGTAACCTCAGCTTTGGGATTCGTGATCTGTGGTTTTGCGCTGATGGTGGCCGTTGCTTTCTTTTCAATAGTGGCTCCACTTTCGTCTGACTTGGGACGCTGTATTAAGCTTGGAGGGGCACTCAGCACCCCTGGGTTTGCAAGGGGTGCTGGAGGGAAAAGCCCTGGGGGAGCAGTGCCTGGAGGGGGTCCCAATGGAGGACGCATCATTGGACGGGGAGGCGGAGGCATACCTGGAGGTGCCGGTGGAGGTAGACGAGGAGGGGGTCCTCGAGGAGGTGGTCCTGGGGGCAAACCTGGTGGAGGACCTGGAGGAGGGCCAGGTGGACGGCCANGGGGGTGGTCCAGGCGGTAGCAGACCGTGGTGGTGGGCCCCGAAGTCCAGGAGGCCTTAGGAATGGAGGAGCACCTGGAGGTGGACCTGGAGGCATCCCAGATGGTGGTCCAGGTGGCCCTGTGGGGTGGGAAACTGGAGGAAGACCAAATTGGGCGGAGGTCCTGTTCATCATATTAGGTGGATGGGAAAAAGTGGGGAAGGGGGGGGGTAAAATAAAAAAAGGGTGGGTGGGAAAAAAAGTCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGAGACCTTCCATTTCTTTCA