ORFeome > MGC69017 ORF1 – XORFeome v1.0

MGC69017 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255471
Gene Page ID:
ORF Xenbase ID: 17259033

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056054
Original XGC clone length: 618

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ824642
dbEST ID: 79642344
Trimmed Sequence: ATGGAGGAAGATATTTTGACCACCCTCAAGATCTTAATTATCGGGGAGAGCGGGGTAGGGAAGTCCAGCCTTCTGTTGAGGTTTACCGACGATACCTTTGACCCGGAACTTGCAGCTACAATAGGTGTTGACTTTAAAGTGAAAACAATCTCTGTAGATGGCAATAAAGCAAAGCTTGCAATATGGGACACTGCAGGACAGGAACGCTTCCGAACCCTAACGCCCAGTTATTACCGGGGTGCACAAGGTGTTATATTGGTGTATGATGTGACTCGGAGGGATACGTTCACGAGGCTGGACAACTGGTTAAATGAGCTGGAGACCTATTGCACAAGAAATGACATTGTTAAGATGCTGGTTGGAAATAAGATAGACAAGGAAAATCGGGAAGTAGATCGAAATGAGGGACTGAAGTTTGCCAGGAAACATTCGATGTTGTATATAGAGGCCAGTGCAAAAACCAGAGATGGAGTACAATGTGCATTCGAAGAACTTGTTGAAAAGATTATCCAGACTCCTGGACTATGGGAAAGTGAGACAAACAGAGGAGTTCGATTGTCTAGTGAAGATGGTGGTGGCACAAGAGGGTTGTGTGCTGGATACTGCTCAGTACAGTT
Full Trace Sequence: CCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAGATATTTTGACCACCCTCAAGATCTTAATTATCGGGGAGAGCGGGGTAGGGAAGTCCAGCCTTCTGTTGAGGTTTACCGACGATACCTTTGACCCGGAACTTGCAGCTACAATAGGTGTTGACTTTAAAGTGAAAACAATCTCTGTAGATGGCAATAAAGCAAAGCTTGCAATATGGGACACTGCAGGACAGGAACGCTTCCGAACCCTAACGCCCAGTTATTACCGGGGTGCACAAGGTGTTATATTGGTGTATGATGTGACTCGGAGGGATACGTTCACGAGGCTGGACAACTGGTTAAATGAGCTGGAGACCTATTGCACAAGAAATGACATTGTTAAGATGCTGGTTGGAAATAAGATAGACAAGGAAAATCGGGAAGTAGATCGAAATGAGGGACTGAAGTTTGCCAGGAAACATTCGATGTTGTATATAGAGGCCAGTGCAAAAACCAGAGATGGAGTACAATGTGCATTCGAAGAACTTGTTGAAAAGATTATCCAGACTCCTGGACTATGGGAAAGTGAGACAAACAGAGGAGTTCGATTGTCTAGTGAAGATGGTGGTGGCACAAGAGGGTTGTGTGCTGGATACTGCTCAGTACAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCATTTTGTTGCACCGAACAGGTCACTATCAGTCAAAATAAAATCATTTATTTGCCATCCCAGCTGATATCCCCCTATATTGAGTCGTATTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAGATATTTTGACCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829993
dbEST ID: 79647695
Trimmed Sequence: CTGTACTGAGCAGTATCCAGCACACAACCCTCTTGTGCCACCACCATCTTCACTAGACAATCGAACTCCTCTGTTTGTCTCACTTTCCCATAGTCCAGGAGTCTGGATAATCTTTTCAACAAGTTCTTCGAATGCACATTGTACTCCATCTCTGGTTTTTGCACTGGCCTCTATATACAACATCGAATGTTTCCTGGCAAACTTCAGTCCCTCATTTCGATCTACTTCCCGATTTTCCTTGTCTATCTTATTTCCAACCAGCATCTTAACAATGTCATTTCTTGTGCAATAGGTCTCCAGCTCATTTAACCAGTTGTCCAGCCTCGTGAACGTATCCCTCCGAGTCACATCATACACCAATATAACACCTTGTGCACCCCGGTAATAACTGGGCGTTAGGGTTCGGAAGCGTTCCTGTCCTGCAGTGTCCCATATTGCAAGCTTTGCTTTATTGCCATCTACAGAGATTGTTTTCACTTTAAAGTCAACACCTATTGTAGCTGCAAGTTCCGGGTCAAAGGTATCGTCGGTAAACCTCAACAGAAGGCTGGACTTCCCTACCCCGCTCTCCCCCATAATTAAGATCTTGAGGGTGGTCAAAATATCTTCCTCCAGGGAGCCC
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTACTGAGCAGTATCCAGCACACAACCCTCTTGTGCCACCACCATCTTCACTAGACAATCGAACTCCTCTGTTTGTCTCACTTTCCCATAGTCCAGGAGTCTGGATAATCTTTTCAACAAGTTCTTCGAATGCACATTGTACTCCATCTCTGGTTTTTGCACTGGCCTCTATATACAACATCGAATGTTTCCTGGCAAACTTCAGTCCCTCATTTCGATCTACTTCCCGATTTTCCTTGTCTATCTTATTTCCAACCAGCATCTTAACAATGTCATTTCTTGTGCAATAGGTCTCCAGCTCATTTAACCAGTTGTCCAGCCTCGTGAACGTATCCCTCCGAGTCACATCATACACCAATATAACACCTTGTGCACCCCGGTAATAACTGGGCGTTAGGGTTCGGAAGCGTTCCTGTCCTGCAGTGTCCCATATTGCAAGCTTTGCTTTATTGCCATCTACAGAGATTGTTTTCACTTTAAAGTCAACACCTATTGTAGCTGCAAGTTCCGGGTCAAAGGTATCGTCGGTAAACCTCAACAGAAGGCTGGACTTCCCTACCCCGCTCTCCCCCATAATTAAGATCTTGAGGGTGGTCAAAATATCTTCCTCCAGGGAGCCCAACTTTTTGGACAAAGTTGGCATTATAAAAAAGCAATTGCTCATCCAATTGGTTGCAACGAAAAAAGGTCACTAACCAAAAAAAAAATAAAATACAATTATTTGGGGGGCCCGAAGCCTTAAGAAATTGGGCGTCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTACTGAGCAGTATCC