ORFeome > MGC69074 ORF1 – XORFeome v1.0

MGC69074 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255467
Gene Page ID:
ORF Xenbase ID: 17259045

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056082
Original XGC clone length: 1338

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ824745
dbEST ID: 79642447
Trimmed Sequence: ATGCGTGAAATAGTTCATCTGCAAATAGGCCAATGTGGCAACCAGATTGGATCAAAGTTCTGGGAGGTGATCAGCGATGAACATGGGATCAATAACCACGGCAGTTATGAGGGCAACTCACACCTACAGCTGGAGAGGCTCAACGTGTACTTCAACGAGGCCCATTCCCAAAAGTATGTTCCAAGAGCCGTGTTGGTAGATCTGGAACCAGGGACCATGGATAGCCTCCGTTCCAGCAGTATTGGACCTCTGTTTCGGCCCGACAGTTTTGTCCATGGAAATTCTGGTGCTGGGAATAACTGGGCTAAGGGACACTACACGGAAGGAGCAGAGCTGATTGAATCAGTAATGGATGTGGTGAGAAGTGAAAGTGAAAGCTGCGACTGTCTACAAGGGTTCCAGCTGGTCCATTCCCTTGGGGGAGGCACAGGTTCTGGAATGGGCACTTTGCTCATTAATAAGATCCGGGAAGAGTACCCAGACAGGATCATGAACACATACAGCATCATGCCCTCTCCCAAAGTCTCCGACACAGTGGTGGAGCCGTACAACGCCATCCTGTCCATCCACCAGTTGATAGAAAACACAGACGAGACCTTCTGCATTGATAATGAAGCCCTGTATGACATCTGCTTCCGCACCTTGAAGTTGACCAACCCAACCTATGGAGATCTCAACCATTTGGTTTCATGACTATGAGTGGAGTGACGACGTCTCTGCGCTTTTCAGGGCAGCTCAACCCCGATCTGAAAAAAGTAGCCCGTCCAACATGGTGGCCTTTTTCCCCGTTCTCCATTTTTCTTTT
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGTGAAATAGTTCATCTGCAAATAGGCCAATGTGGCAACCAGATTGGATCAAAGTTCTGGGAGGTGATCAGCGATGAACATGGGATCAATAACCACGGCAGTTATGAGGGCAACTCACACCTACAGCTGGAGAGGCTCAACGTGTACTTCAACGAGGCCCATTCCCAAAAGTATGTTCCAAGAGCCGTGTTGGTAGATCTGGAACCAGGGACCATGGATAGCCTCCGTTCCAGCAGTATTGGACCTCTGTTTCGGCCCGACAGTTTTGTCCATGGAAATTCTGGTGCTGGGAATAACTGGGCTAAGGGACACTACACGGAAGGAGCAGAGCTGATTGAATCAGTAATGGATGTGGTGAGAAGTGAAAGTGAAAGCTGCGACTGTCTACAAGGGTTCCAGCTGGTCCATTCCCTTGGGGGAGGCACAGGTTCTGGAATGGGCACTTTGCTCATTAATAAGATCCGGGAAGAGTACCCAGACAGGATCATGAACACATACAGCATCATGCCCTCTCCCAAAGTCTCCGACACAGTGGTGGAGCCGTACAACGCCATCCTGTCCATCCACCAGTTGATAGAAAACACAGACGAGACCTTCTGCATTGATAATGAAGCCCTGTATGACATCTGCTTCCGCACCTTGAAGTTGACCAACCCAACCTATGGAGATCTCAACCATTTGGTTTCATGACTATGAGTGGAGTGACGACGTCTCTGCGCTTTTCAGGGCAGCTCAACCCCGATCTGAAAAAAGTAGCCCGTCCAACATGGTGGCCTTTTTCCCCGTTCTCCATTTTTCTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGTGAAATAGTTCATCTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830097
dbEST ID: 79647799
Trimmed Sequence: TTCTTCAGCCACTTCCTCCTCCTCTTCAAAATATTCTTCCATTTCAGCAGTGGCCTCCTGGTATTGTTGGTATTCAGCGATGAGATCGTGGGTGTTGCATTCGGCTTCGGTAAACTCCATTTCGTCCATGCCCTCACCAGTGTACCAGTGCAAGAAAGCTTTCCGGCGATACATGGCAGAGAACTGCTCAGCGATCCTCCTGAAGATCTCTTGAATGGCTGTGTTATTCCCAATGAAAGTGGATGCCAGCTTGAGGCCACGGGGTGGTATGTCACAGACGGCCACCTTGACATTGTTTGGGATCCACTCTACAAAATAGGCGCTGTTCTTGGTCTGCATAGACAGCATTTGCTCATCTACTTCTTTGGTGGACATCAGACCGCGAAAGATACCAGCAACTGTTAGGTAGCGGCCATGGCGTGGGTCACAAGCTGTCATCATCGATCTGGCATCAAACATCTGCTGGGTCAGCTCAGCCACTGTCACTGCTTTGTACTGCTGGCTTCTGCGCGATGTTAGAGGAGCACAGCTCGTCATAAAGAAATGGAGACGTGGAAAAGGCACCATGTTGACGGCTAACTTTCTCAGATCGGCGTTGAGCTGCCCTGGAAAGCGCAGAGACGTCGTCACTCCACTCATAGTCATGGAAACCAAATGGTTGAGATCTCCAATAGGGTGGGTTGGGTCAACCTCCAGGGTGGCGAAAGCACGATGTTATAACGGGGCTTCATTATAAAAGGGAAAAAAGGCCCTCCCCTCGGGGGT
Full Trace Sequence: GTGCCGGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTCAGCCACTTCCTCCTCCTCTTCAAAATATTCTTCCATTTCAGCAGTGGCCTCCTGGTATTGTTGGTATTCAGCGATGAGATCGTGGGTGTTGCATTCGGCTTCGGTAAACTCCATTTCGTCCATGCCCTCACCAGTGTACCAGTGCAAGAAAGCTTTCCGGCGATACATGGCAGAGAACTGCTCAGCGATCCTCCTGAAGATCTCTTGAATGGCTGTGTTATTCCCAATGAAAGTGGATGCCAGCTTGAGGCCACGGGGTGGTATGTCACAGACGGCCACCTTGACATTGTTTGGGATCCACTCTACAAAATAGGCGCTGTTCTTGGTCTGCATAGACAGCATTTGCTCATCTACTTCTTTGGTGGACATCAGACCGCGAAAGATACCAGCAACTGTTAGGTAGCGGCCATGGCGTGGGTCACAAGCTGTCATCATCGATCTGGCATCAAACATCTGCTGGGTCAGCTCAGCCACTGTCACTGCTTTGTACTGCTGGCTTCTGCGCGATGTTAGAGGAGCACAGCTCGTCATAAAGAAATGGAGACGTGGAAAAGGCACCATGTTGACGGCTAACTTTCTCAGATCGGCGTTGAGCTGCCCTGGAAAGCGCAGAGACGTCGTCACTCCACTCATAGTCATGGAAACCAAATGGTTGAGATCTCCAATAGGGTGGGTTGGGTCAACCTCCAGGGTGGCGAAAGCACGATGTTATAACGGGGCTTCATTATAAAAGGGAAAAAAGGCCCTCCCCTCGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTCAGCCACTTCCTC