ORFeome > MGC69084 ORF1 – XORFeome v1.0

MGC69084 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254960
Gene Page ID:
ORF Xenbase ID: 17259051

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059334
Original XGC clone length: 2994

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ824717
dbEST ID: 79642419
Trimmed Sequence: ATGGAGACGTCAGACGATCAGGGCCCAGTTGCCAAGAAATATGATTGAAAATAGTATGTTTGAAGAAGAACCGGATGTGGTTGACTTGGCCAAAGAGCCAACTATGAATTCTTTAGAGTCTGAGGAAATGGAGTACGAACCAAGAAGCTCTAGATTACTGGTTCGTGGACTGGGCGAACATGAATTGGATGAAGATGAAGAGGATTATGAATCCTCTGCAAAACTGCTAGGCATGTCATTCATGAACAGAAGCTCAGGTCTTCGCAATAGTGCCACAAACTACAGGCAGGTTCGAGATGGATTGTGCCCAGTGTCTTCTCCAAGGACAGTTATTGTGTGTGTAGTTGTTGTCATCATTGCAGTCTCTTTAGTTACTGTGGTTTATCTTCTTCCAAAGTGTACCTTTACCAAAGAGGGATGCCATGAAAAAAAAGCAATGGAACTAGTTTATCCTATTGCTAGAAATGGAAAAGTTTTCCCATGGGCAATAAGTAGACTTCCAAATTCCATAAAACCGATACATTATATTCTTACCTTACATCCAAACATGACAACCATGTCTTTTACTGGCACTGTTCAGATAAATCTGAATATCACTGCACGCTCCAAGAATATTGTGCTACATAGCTCAGACCTTCGCATCACATACGCAAATGTTTTGGTACCTGGGGGAAACACTATGGATGCTGAGGGTCTGGAATATCCCAGGTTTTGAGGAGAATGCTACTAGTTGCACCTGAATCATTGCCCAAAGGGCCATTTGGCTTGGCTACCATTTGGATAATACCTCCTAACTTTTCAAGCCGCCTTTTATTGGGATTTTTACCAAAATTTGATTAACCTGGAAATA
Full Trace Sequence: ATTTTTATTTTTCGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACGTCAGACGATCAGGGCCCAGTTGCCAAGAAATATGATTGAAAATAGTATGTTTGAAGAAGAACCGGATGTGGTTGACTTGGCCAAAGAGCCAACTATGAATTCTTTAGAGTCTGAGGAAATGGAGTACGAACCAAGAAGCTCTAGATTACTGGTTCGTGGACTGGGCGAACATGAATTGGATGAAGATGAAGAGGATTATGAATCCTCTGCAAAACTGCTAGGCATGTCATTCATGAACAGAAGCTCAGGTCTTCGCAATAGTGCCACAAACTACAGGCAGGTTCGAGATGGATTGTGCCCAGTGTCTTCTCCAAGGACAGTTATTGTGTGTGTAGTTGTTGTCATCATTGCAGTCTCTTTAGTTACTGTGGTTTATCTTCTTCCAAAGTGTACCTTTACCAAAGAGGGATGCCATGAAAAAAAAGCAATGGAACTAGTTTATCCTATTGCTAGAAATGGAAAAGTTTTCCCATGGGCAATAAGTAGACTTCCAAATTCCATAAAACCGATACATTATATTCTTACCTTACATCCAAACATGACAACCATGTCTTTTACTGGCACTGTTCAGATAAATCTGAATATCACTGCACGCTCCAAGAATATTGTGCTACATAGCTCAGACCTTCGCATCACATACGCAAATGTTTTGGTACCTGGGGGAAACACTATGGATGCTGAGGGTCTGGAATATCCCAGGTTTTGAGGAGAATGCTACTAGTTGCACCTGAATCATTGCCCAAAGGGCCATTTGGCTTGGCTACCATTTGGATAATACCTCCTAACTTTTCAAGCCGCCTTTTATTGGGATTTTTACCAAAATTTGATTAACCTGGAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACGTCAAACGATCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ830069
dbEST ID: 79647771
Trimmed Sequence: GTGGGAGGGCAACAACCAGGTCTTAAGGCTATCAAGGTTATTTTTCATCCATTTGATGTTCAGCTTGATTGTCTCCAAGGCCTCTTTGACATACCACACTTCTCTGCTCTTCTCCTTGGTTGAATTAAAAAAATGCAGTAACTTCTGTGTTATCAAATTCCAGTTCTGCTTGACAAAGTTCCAGGCCAGCAAATATCCAGGTGATCTTCGACAGATGAATGAAATAACATTAGGCAGCTCCTGAGATCTTATAGAGCCCCCAGCGAGACTCTCCTGCATCAACCCCTGTAAATCTTTAGCATTATCTGTACTTGCAAGAGCTTCGAGGATTTTACTCTTTTCTGATTCATAGATTGAAGAATCGTATCTACGCCGGAGAAAGGTCCAGCCTTCTGTAGTTTTTGTACCAACCTTAAACACAATATTTATAACGTCGGAGGGAATTCTTGTTTCATTAAAACGCCAACTATTAAATAGCTCTGTTGCTCTATCTAAACAGTTTAGAACGCCATTTGAACAGGCAAAATCCAGGAGAGAAGTTCTCAACTCTCGTTCAGCAAGTGTTCCTTCATCTTTCCATGTTTGTTTGATGAGAGTATTATTGAGTAGATCTAAACCACGCTCCATTAGTTTGTCGGACAGGTCATCCCAACCCACGCTTTATACAGATACGGCGAATATGGGTAAAACTGGGTGCCAGGCTTGAAATGAGGGGGGGCACCTGGTCTGTTTTCATTTCCCAAGGGGTTACCCCAAAACCAAGTTA
Full Trace Sequence: GGCCGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGGAGGGCAACAACCAGGTCTTAAGGCTATCAAGGTTATTTTTCATCCATTTGATGTTCAGCTTGATTGTCTCCAAGGCCTCTTTGACATACCACACTTCTCTGCTCTTCTCCTTGGTTGAATTAAAAAAATGCAGTAACTTCTGTGTTATCAAATTCCAGTTCTGCTTGACAAAGTTCCAGGCCAGCAAATATCCAGGTGATCTTCGACAGATGAATGAAATAACATTAGGCAGCTCCTGAGATCTTATAGAGCCCCCAGCGAGACTCTCCTGCATCAACCCCTGTAAATCTTTAGCATTATCTGTACTTGCAAGAGCTTCGAGGATTTTACTCTTTTCTGATTCATAGATTGAAGAATCGTATCTACGCCGGAGAAAGGTCCAGCCTTCTGTAGTTTTTGTACCAACCTTAAACACAATATTTATAACGTCGGAGGGAATTCTTGTTTCATTAAAACGCCAACTATTAAATAGCTCTGTTGCTCTATCTAAACAGTTTAGAACGCCATTTGAACAGGCAAAATCCAGGAGAGAAGTTCTCAACTCTCGTTCAGCAAGTGTTCCTTCATCTTTCCATGTTTGTTTGATGAGAGTATTATTGAGTAGATCTAAACCACGCTCCATTAGTTTGTCGGACAGGTCATCCCAACCCACGCTTTATACAGATACGGCGAATATGGGTAAAACTGGGTGCCAGGCTTGAAATGAGGGGGGGCACCTGGTCTGTTTTCATTTCCCAAGGGGTTACCCCAAAACCAAGTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGGAGGGCAACAACCAG