ORFeome > MGC69098 ORF1 – XORFeome v1.0

MGC69098 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255464
Gene Page ID:
ORF Xenbase ID: 17259075

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056089
Original XGC clone length: 1197

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ824722
dbEST ID: 79642424
Trimmed Sequence: ATGAACTCAGGAGAGGAAACAGCGGTCATTATATCTGCAGCCCGCACCCCTATAGGTTCATTCAATGGTGCCCTATCTACCTTACCTGCCCACACTCTGGGCTCTACTGTTATCAAAGAAGTGTTGAAGAGAGCCACCATTAAACCAGAAGAAGTCTCTGAGGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGTGTAGCTGCAGGTGTTCCTTACAGTATTCCAGCGTGGAGCTGCCAAATGATATGTGGGTCTGGCCTAAAGGCTGTGAGCCTCGGGGCTCAGTCTATAAAGACAGGGGAGGCTGATATTGTTGTGGCGGGTGGTATGGAGAACATGAGTCAGGCTCCTCATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGAGATGTCTCCTTGCAGGACAGTATCATATGTGATGGCCTAAATGATGCCTTTTACAAGTATCACATGGGAATAACTGCTGAAAATGTGGCCAAACAATGGCAAATAACCAGAGAGGAACAGGATCAGCTTGCTGTGCAGTCACAAAACAGAACCGAGGCAGCACAAAAAGCTGGCTATTTCGACAAAGAGATTNGTGCCTGTTTCAGTTCCTTCCAGAANAGGGCCTGTGGGAGGTAAAAAGTTGATGAGTTTCCTCGACATGGAAAGCATGTCGAAAGCATGTCAAAATATAAGCCATATTTTCGAAAAGGATGGAAAATGGAAACAGTACTCCAGCCAAATGCCTCAAGTATCAATGACGGAACAAACCAGCTGTAATTTTTTAAAAAAAGGAGCTAAAACAAAAAAACCACAGGGGGTTTTATCCCCCCGGGCACG
Full Trace Sequence: ATTTTTATTTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTCAGGAGAGGAAACAGCGGTCATTATATCTGCAGCCCGCACCCCTATAGGTTCATTCAATGGTGCCCTATCTACCTTACCTGCCCACACTCTGGGCTCTACTGTTATCAAAGAAGTGTTGAAGAGAGCCACCATTAAACCAGAAGAAGTCTCTGAGGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGTGTAGCTGCAGGTGTTCCTTACAGTATTCCAGCGTGGAGCTGCCAAATGATATGTGGGTCTGGCCTAAAGGCTGTGAGCCTCGGGGCTCAGTCTATAAAGACAGGGGAGGCTGATATTGTTGTGGCGGGTGGTATGGAGAACATGAGTCAGGCTCCTCATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGAGATGTCTCCTTGCAGGACAGTATCATATGTGATGGCCTAAATGATGCCTTTTACAAGTATCACATGGGAATAACTGCTGAAAATGTGGCCAAACAATGGCAAATAACCAGAGAGGAACAGGATCAGCTTGCTGTGCAGTCACAAAACAGAACCGAGGCAGCACAAAAAGCTGGCTATTTCGACAAAGAGATTNGTGCCTGTTTCAGTTCCTTCCAGAANAGGGCCTGTGGGAGGTAAAAAGTTGATGAGTTTCCTCGACATGGAAAGCATGTCGAAAGCATGTCAAAATATAAGCCATATTTTCGAAAAGGATGGAAAATGGAAACAGTACTCCAGCCAAATGCCTCAAGTATCAATGACGGAACAAACCAGCTGTAATTTTTTAAAAAAAGGAGCTAAAACAAAAAAACCACAGGGGGTTTTATCCCCCCGGGCACG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCAGGAGAGGAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ830074
dbEST ID: 79647776
Trimmed Sequence: ACTGGTTCGTTCAACGCACATGGCTATTCCCATTCCTCCTCCTATGCATAATGCAGCCACTCCTTTTTTCCCACCAGTTCTTTCTAAGGCATAAAGTAGAGTAACCAAAATTCGACAGCCAGACATTCCGAGAGGGTGACCGAGGGCCACGGCACCACCTTGACAGTTGACTTTTTCTGGGTTAAGGCCCAAGTCTTTAACCACTGCCAAAGCCTGAGCTGCAAAGGCCTCGTTTATTTCAAATAAATCAATGTCATCTAGGCTCCAGCCTGCTTTTTCAACTGCTTTTCTAATTGCCGCAATAGGTCCCACTCCCATAATGGAGGGATCCAAGCCTGCTTGCGCCGAGGCGACTATCCGTGCCAGTGGAGTCAGACCCCTGCGTCTTGCTTCAGCCTCCTTTATTAAAACTACAGCTGCTGCTCCGTCATTGATACCTGAGGCATTTGCTGGAGTAACTGTTCCACTTCCATCCTTCAGAAAATATGGCTTTAATTTTGACATTGCTTCGACATTGCTTCCATGTCGAGGAAACTCATCAACTTTTACCTCCACAGGCCCTTTTCTGGAAGGAACTGAAACANGCACAATCTCTTTGTCGAAATAGCCAGCTTTTTGTGCTGCCTCGGTTTCTGTTTTGTGACTGCACAGCAAGCTGATCCTGTTCCNTCTCTGGGTTATTTTGCCATTGTTTTGGGCACCATTTTTCAGCCATTATTTCCCCATGTTGAAACTTTGTAAAAAAGGGCATCATTTTAAGGGCCAACCA
Full Trace Sequence: CAGGTAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGGTTCGTTCAACGCACATGGCTATTCCCATTCCTCCTCCTATGCATAATGCAGCCACTCCTTTTTTCCCACCAGTTCTTTCTAAGGCATAAAGTAGAGTAACCAAAATTCGACAGCCAGACATTCCGAGAGGGTGACCGAGGGCCACGGCACCACCTTGACAGTTGACTTTTTCTGGGTTAAGGCCCAAGTCTTTAACCACTGCCAAAGCCTGAGCTGCAAAGGCCTCGTTTATTTCAAATAAATCAATGTCATCTAGGCTCCAGCCTGCTTTTTCAACTGCTTTTCTAATTGCCGCAATAGGTCCCACTCCCATAATGGAGGGATCCAAGCCTGCTTGCGCCGAGGCGACTATCCGTGCCAGTGGAGTCAGACCCCTGCGTCTTGCTTCAGCCTCCTTTATTAAAACTACAGCTGCTGCTCCGTCATTGATACCTGAGGCATTTGCTGGAGTAACTGTTCCACTTCCATCCTTCAGAAAATATGGCTTTAATTTTGACATTGCTTCGACATTGCTTCCATGTCGAGGAAACTCATCAACTTTTACCTCCACAGGCCCTTTTCTGGAAGGAACTGAAACANGCACAATCTCTTTGTCGAAATAGCCAGCTTTTTGTGCTGCCTCGGTTTCTGTTTTGTGACTGCACAGCAAGCTGATCCTGTTCCNTCTCTGGGTTATTTTGCCATTGTTTTGGGCACCATTTTTCAGCCATTATTTCCCCATGTTGAAACTTTGTAAAAAAGGGCATCATTTTAAGGGCCAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTTCGTTCAACGCACAT