ORFeome > MGC69127 ORF1 – XORFeome v1.0

MGC69127 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255179
Gene Page ID:
ORF Xenbase ID: 17259111

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057751
Original XGC clone length: 1281

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ824699
dbEST ID: 79642401
Trimmed Sequence: ATGCCCATCCCTCCTCCCCCGCCCCCACCTCCGGGGCCACCCCCACCACCAACCTTTGCACAGGCCAACACTGAGCCCCCCAAACTGAGACGAGATGAGCAGAAGGGCAGGAACGCTCTGCTCGGTGACATTTGCAAGGGAGCCAAACTGAAGAAAACAACAGGGGTCAATGATAGGAGCGCCCCTGTACTGGAGACACCTAAAGGTGGAGCAGGTGGTCCTGGTTTTGGAGCCACCCCAGGAATGGCCTTGCAGCCCAAAGGAGGCCTTTTCGCAGGAGGAGTCCCAAAGTTGCAAGCTGTGGGGACTAAGGATAGCCCAGAAGGCCGCTCTCCTCTTCAGGCTCCGGCTGCTCGTTCGTCAGCACCCCGGCCCCCAGTGTCAGGCGGAAGACCCCAGGATGACTCTGACAGTGGCAGTAACCGGTCTTCACCACCAGAAGTGGGACGTGCCCATCGTCCATCCCTGCCCGACCTCACTCGTCCTCCCAGTTCCACCAGCTCCGGCATGAAGCACAGTTCATCTGCCCCTCCCCCACCTCCTCCTGGACGCAGACAGGCTGGTGCTCCACCTGCACCTTCCCAAAATGCCAAACCTTACAACAGAGAGAAACCTCTACCACCAACTCCAGGGCACCGGGCCCCTGCTGCACCTCAAGTGAAACCTCCACCTCCTCCAATTAACACACGTTCCCCCAGCACACACAGCCGACCCCCCACCACCTCCTCCATACAGGCAACCCCCCTCCTTCCCATACGGGACCCCCCTAGTTCCCATAAATGAGCCCTGCCGCCCGAAATTACCCCCAAAAGGCACAACTTTAATTTCTAAAGGGAAAAC
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCATCCCTCCTCCCCCGCCCCCACCTCCGGGGCCACCCCCACCACCAACCTTTGCACAGGCCAACACTGAGCCCCCCAAACTGAGACGAGATGAGCAGAAGGGCAGGAACGCTCTGCTCGGTGACATTTGCAAGGGAGCCAAACTGAAGAAAACAACAGGGGTCAATGATAGGAGCGCCCCTGTACTGGAGACACCTAAAGGTGGAGCAGGTGGTCCTGGTTTTGGAGCCACCCCAGGAATGGCCTTGCAGCCCAAAGGAGGCCTTTTCGCAGGAGGAGTCCCAAAGTTGCAAGCTGTGGGGACTAAGGATAGCCCAGAAGGCCGCTCTCCTCTTCAGGCTCCGGCTGCTCGTTCGTCAGCACCCCGGCCCCCAGTGTCAGGCGGAAGACCCCAGGATGACTCTGACAGTGGCAGTAACCGGTCTTCACCACCAGAAGTGGGACGTGCCCATCGTCCATCCCTGCCCGACCTCACTCGTCCTCCCAGTTCCACCAGCTCCGGCATGAAGCACAGTTCATCTGCCCCTCCCCCACCTCCTCCTGGACGCAGACAGGCTGGTGCTCCACCTGCACCTTCCCAAAATGCCAAACCTTACAACAGAGAGAAACCTCTACCACCAACTCCAGGGCACCGGGCCCCTGCTGCACCTCAAGTGAAACCTCCACCTCCTCCAATTAACACACGTTCCCCCAGCACACACAGCCGACCCCCCACCACCTCCTCCATACAGGCAACCCCCCTCCTTCCCATACGGGACCCCCCTAGTTCCCATAAATGAGCCCTGCCGCCCGAAATTACCCCCAAAAGGCACAACTTTAATTTCTAAAGGGAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCATCCCTCCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ830051
dbEST ID: 79647753
Trimmed Sequence: CCTGAGGATAGGAGGAAGAGGAGGGACTCCACGCGTGGCTCTGATGCTTTTGCTTGGATAGATTTTCTGAAAGGGTTTGTAGTCTTCAGGGGCTGGAAAATCATCCACGGAATGAAAGGAATATTTCGATTCAAAATCATCTTTCCAGGAATTTAACATTCCATTCCTGACTGGAGGAGGAGGTGGTGGTGGTCCTGAGGGGGTCCGAGATGGAGGTGGAGGAGGCTTGGCCCTGTTGGGGGTGGTCTCAGGGATGCAGTGCATTCTGTAAGGGGGCGGTGGAGGTGGGGGAGCATCCCGGCCTCCATTACGCACAATAAGTGGAGGTGGTGGTGGTGGAGCTGCTCCTCTTCCTGGGGGATCTCTCGCTGGTGGAGGTGGTCTGTTGCCTCCAGGAGATAAATGGACCGATTGCGGACGAGGGGGTGCTAGTCCTCTCACAGGTCCAGCGGTTTTCCTATCACATGAGTTGTGCCTCTGGAGCAACTCTGGCGCAAGCTCATTTATGGGACTAAGGTGTCCATTATGAAAACGAGGTTGTTGCCTGCATGGATGACGTTGTTGGCCGGCCTGATGGATGTCCATCCCGGACTTCCGATGGGAAAAAAAGAACGTGAGCCTCGTGATATGAGAAAGTGGTTCCCCCTTGGTACCACCCAATTTCCACGGAACAAACTAACACCGATTTTCCTTCCGGTCCGGCCAGTGAATACCACCCGACGAAATTTCCGGGCAGGCTTCCTACTGTTAAAAACTTCCCCCAAA
Full Trace Sequence: CTGGCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTGAGGATAGGAGGAAGAGGAGGGACTCCACGCGTGGCTCTGATGCTTTTGCTTGGATAGATTTTCTGAAAGGGTTTGTAGTCTTCAGGGGCTGGAAAATCATCCACGGAATGAAAGGAATATTTCGATTCAAAATCATCTTTCCAGGAATTTAACATTCCATTCCTGACTGGAGGAGGAGGTGGTGGTGGTCCTGAGGGGGTCCGAGATGGAGGTGGAGGAGGCTTGGCCCTGTTGGGGGTGGTCTCAGGGATGCAGTGCATTCTGTAAGGGGGCGGTGGAGGTGGGGGAGCATCCCGGCCTCCATTACGCACAATAAGTGGAGGTGGTGGTGGTGGAGCTGCTCCTCTTCCTGGGGGATCTCTCGCTGGTGGAGGTGGTCTGTTGCCTCCAGGAGATAAATGGACCGATTGCGGACGAGGGGGTGCTAGTCCTCTCACAGGTCCAGCGGTTTTCCTATCACATGAGTTGTGCCTCTGGAGCAACTCTGGCGCAAGCTCATTTATGGGACTAAGGTGTCCATTATGAAAACGAGGTTGTTGCCTGCATGGATGACGTTGTTGGCCGGCCTGATGGATGTCCATCCCGGACTTCCGATGGGAAAAAAAGAACGTGAGCCTCGTGATATGAGAAAGTGGTTCCCCCTTGGTACCACCCAATTTCCACGGAACAAACTAACACCGATTTTCCTTCCGGTCCGGCCAGTGAATACCACCCGACGAAATTTCCGGGCAGGCTTCCTACTGTTAAAAACTTCCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGAGGATAGGAGGAAGA