ORFeome > MGC81468 ORF1 – XORFeome v1.0

MGC81468 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 8596276
Gene Page ID:
ORF Xenbase ID: 17260221

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106699
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ837259
dbEST ID: 79654961
Trimmed Sequence: ATGATGATGATGGCGTTGAGCAAGACCTTCGGGCAGAAGCCCGTCAAGTTTCAGCTGGAGGACGACGGGGAGTTCTACATGATCGGCTCCGAGGTGGGAAACTACCTGCGTATGTTCCGAGGTTCTCTGTACAAGAGATACCCCTCACTCTGGCGGCGACTAGCCACTGTGGAAGAAAGGAAGAAAATAGTGGCATCGTCACATGATCATGGATATACCACCCTGGCCACCAGCGTGACACTCCTGAAAGCCTCAGAGGTAGAAGAGATCCTGGATGGCAATGACGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCGACCTACCTCAGGGAGCAGAAGGCCAAGAGGAACAGCCAGTGGGTCCCCACCCTGCCCAACAGCTCCCACCACCTGGATGCTGTGCCCTGTTCCACCACCATCAACAGGAACCGCATGGGTCGGGACAAGAAGAGAACCTTCCCCTTGTGCTTTGATGACCACGACCCAGCTGTGATCCATGAGAATGCGTCACAGCCTGAGGTGCTGGTGCCCATCCGGCTCGACATGGAGATCGACGGGCAGAAGCTGCGAGACGCTTTTACCTGGAACAAGAATGAGAAGCTAATGACTCCGGAGATGTTTTCAGAAATACTTTGTGATGAACCTGGAATTTGAATCCACCTGACTTTGGTTGCACCTATTGCCCTCTGCCATTCCCCCGCAGAATTAAGTCCTACCCCGCGAAACAGCATCCTTAAAAGAAACCAATCCAAACAACCCGTGGCCTCCGTCAGGCCGGAAACATTTCCCATTTGGGGGAAAAAATCTTCCCCG
Full Trace Sequence: CCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGATGATGGCGTTGAGCAAGACCTTCGGGCAGAAGCCCGTCAAGTTTCAGCTGGAGGACGACGGGGAGTTCTACATGATCGGCTCCGAGGTGGGAAACTACCTGCGTATGTTCCGAGGTTCTCTGTACAAGAGATACCCCTCACTCTGGCGGCGACTAGCCACTGTGGAAGAAAGGAAGAAAATAGTGGCATCGTCACATGATCATGGATATACCACCCTGGCCACCAGCGTGACACTCCTGAAAGCCTCAGAGGTAGAAGAGATCCTGGATGGCAATGACGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCGACCTACCTCAGGGAGCAGAAGGCCAAGAGGAACAGCCAGTGGGTCCCCACCCTGCCCAACAGCTCCCACCACCTGGATGCTGTGCCCTGTTCCACCACCATCAACAGGAACCGCATGGGTCGGGACAAGAAGAGAACCTTCCCCTTGTGCTTTGATGACCACGACCCAGCTGTGATCCATGAGAATGCGTCACAGCCTGAGGTGCTGGTGCCCATCCGGCTCGACATGGAGATCGACGGGCAGAAGCTGCGAGACGCTTTTACCTGGAACAAGAATGAGAAGCTAATGACTCCGGAGATGTTTTCAGAAATACTTTGTGATGAACCTGGAATTTGAATCCACCTGACTTTGGTTGCACCTATTGCCCTCTGCCATTCCCCCGCAGAATTAAGTCCTACCCCGCGAAACAGCATCCTTAAAAGAAACCAATCCAAACAACCCGTGGCCTCCGTCAGGCCGGAAACATTTCCCATTTGGGGGAAAAAATCTTCCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGATGATGGCGTTGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837258
dbEST ID: 79654960
Trimmed Sequence: CCAGGCTGGGGCAGTGTTGGCAAGACGCCTCATTCGCCTTGTGTTCCTATCTTGATCCCGGATCTTTTTCTCCATCTCGGCATCAGTCAGTGTCTCCAGCAGGGGGCACCACTGGTCAGCATCTCCGGTATTTCGGATGGCAATCTCCACTGTGGGAAGTGGGTTCTCACTGAAGGCATAGGTCTTCTGGTGCCAGCTCAGCTGTCCTCGGATGCTGTATGCAATGGTGGTGACAAACTCCCCGCCCAAGCCCAGCTCTGAGCACAGCTTCAGGGCAAACTTCTCTGGGGAGTTCTCTTTCTCTGACATGTCCCACTCAAACTGGTCCACCAGGGAGATGTTCCCCACGTGGATGTTCAGCTTGATGATGACACGCTGGTCGGATTGATCCTCTAGGATGCTGTCTGTGGAGTAGGACTCAATCTGCTGTCGAATGGAAGAGGCAATAGCTGGCACAAAAGTCAGTGGATTCAAATCCAGGTGATCACAAACTATTTCTGAAAACAACTCAAGAGTCGGGAGCTTCTCGTTCATGTTTCAAGTGAAAAGCGCTCACAGCTTCTGGCCGTCGAACTCCATGTCTAAGCGGGAGGGGCGGGAGCGCCTCAGGCTGTGGACGCAGTCGTCATGATCAGCACATGAGTGGTGGTCGGTGGAAGCGCAAAGGGAAAGGTTCCCCTGGTATGGTCCACACCCATGGCGGCGTCCAGGTGGGGTTGG
Full Trace Sequence: GGAAAAATGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGGCTGGGGCAGTGTTGGCAAGACGCCTCATTCGCCTTGTGTTCCTATCTTGATCCCGGATCTTTTTCTCCATCTCGGCATCAGTCAGTGTCTCCAGCAGGGGGCACCACTGGTCAGCATCTCCGGTATTTCGGATGGCAATCTCCACTGTGGGAAGTGGGTTCTCACTGAAGGCATAGGTCTTCTGGTGCCAGCTCAGCTGTCCTCGGATGCTGTATGCAATGGTGGTGACAAACTCCCCGCCCAAGCCCAGCTCTGAGCACAGCTTCAGGGCAAACTTCTCTGGGGAGTTCTCTTTCTCTGACATGTCCCACTCAAACTGGTCCACCAGGGAGATGTTCCCCACGTGGATGTTCAGCTTGATGATGACACGCTGGTCGGATTGATCCTCTAGGATGCTGTCTGTGGAGTAGGACTCAATCTGCTGTCGAATGGAAGAGGCAATAGCTGGCACAAAAGTCAGTGGATTCAAATCCAGGTGATCACAAACTATTTCTGAAAACAACTCAAGAGTCGGGAGCTTCTCGTTCATGTTTCAAGTGAAAAGCGCTCACAGCTTCTGGCCGTCGAACTCCATGTCTAAGCGGGAGGGGCGGGAGCGCCTCAGGCTGTGGACGCAGTCGTCATGATCAGCACATGAGTGGTGGTCGGTGGAAGCGCAAAGGGAAAGGTTCCCCTGGTATGGTCCACACCCATGGCGGCGTCCAGGTGGGGTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGCTGGGGCAGTGT