ORFeome > MGC82408 ORF2 – XORFeome v1.0

MGC82408 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251739
Gene Page ID:
ORF Xenbase ID: 17260671

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130097
Original XGC clone length: 483

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ837614
dbEST ID: 79655316
Trimmed Sequence: ATGGGCCTCGAGAAGGAGACGGCAGATGCCCGCATCTTTATGGATGAACATGAACTGAGTCACAGCACTGTCCCCATGCTGACTGAGAAATCCTTCCACAACAGCCACGACCGTGATCCCAAGAGGTTGAACTCCCACCTGAAGATAACATTTGAGGATGTGATTGGAGAGCCGGATACAACTCACAGCTTCGACAGGGTCTGGGTGTGCAGCACAGCTCTGTTTGAGATCAGCAAATACCTGATCTACAAGGTCCTGACTGTCCTACTTGCTGTGCCGCTGGCATTTGTTGTGGGAATTCTGTTTGCAGTGCTCAGCTGCCTACACATTTGGATTATGATGCCTTTCGCAAAGAGCTGTATGATGATGTTGCCCTCTGTACAGAAGATATGGAAGGGTGTGACAGATAGCTTTATTGCTCCCATATTTGCAAGCATGGGACGATGTTTTTCTAATGTTAACATTCAGCTGGATCGGGATTT
Full Trace Sequence: GCTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCCTCGAGAAGGAGACGGCAGATGCCCGCATCTTTATGGATGAACATGAACTGAGTCACAGCACTGTCCCCATGCTGACTGAGAAATCCTTCCACAACAGCCACGACCGTGATCCCAAGAGGTTGAACTCCCACCTGAAGATAACATTTGAGGATGTGATTGGAGAGCCGGATACAACTCACAGCTTCGACAGGGTCTGGGTGTGCAGCACAGCTCTGTTTGAGATCAGCAAATACCTGATCTACAAGGTCCTGACTGTCCTACTTGCTGTGCCGCTGGCATTTGTTGTGGGAATTCTGTTTGCAGTGCTCAGCTGCCTACACATTTGGATTATGATGCCTTTCGCAAAGAGCTGTATGATGATGTTGCCCTCTGTACAGAAGATATGGAAGGGTGTGACAGATAGCTTTATTGCTCCCATATTTGCAAGCATGGGACGATGTTTTTCTAATGTTAACATTCAGCTGGATCGGGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCCATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCTCCCGCTAATATCCCCTATTATGAATCGTATTACATGGTTCATAGCTGTTTTCAAGAAAAATTAAAACCAATGTTTAAAAATATATTGGGTATCTCAACGGCCCCCAAGGAAAAAAAAGGGCCCCTTTCCGACCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCTCGAGAAGGAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837613
dbEST ID: 79655315
Trimmed Sequence: ATCCCGATCCAGCTGAATGTTAACATTAGAAAAACATCGTCCCATGCTTGCAAATATGGGAGCAATAAAGCTATCTGTCACACCCTTCCATATCTTCTGTACAGAGGGCAACATCATCATACAGCTCTTTGCGAAAGGCATCATAATCCAAATGTGTAGGCAGCTGAGCACTGCAAACAGAATTCCCACAACAAATGCCAGCGGCACAGCAAGTAGGACAGTCAGGACCTTGTAGATCAGGTATTTGCTGATCTCAAACAGAGCTGTGCTGCACACCCAGACCCTGTCGAAGCTGTGAGTTGTATCCGGCTCTCCNATCACATCCTCACATGTTATCTTCAGGTGGGAGTTCAACCTCTTGGGATCACGGTCGTGGCTGTTGTGGAAGGATTTCTCACTCAGCATGGGGACAGTGCTGTGACTCAATTCATGTTCATCCATAAAGATGCGGGCATCTGCCGTCTCCTTCTCGAGGCCCATGG
Full Trace Sequence: GTGTAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCCGATCCAGCTGAATGTTAACATTAGAAAAACATCGTCCCATGCTTGCAAATATGGGAGCAATAAAGCTATCTGTCACACCCTTCCATATCTTCTGTACAGAGGGCAACATCATCATACAGCTCTTTGCGAAAGGCATCATAATCCAAATGTGTAGGCAGCTGAGCACTGCAAACAGAATTCCCACAACAAATGCCAGCGGCACAGCAAGTAGGACAGTCAGGACCTTGTAGATCAGGTATTTGCTGATCTCAAACAGAGCTGTGCTGCACACCCAGACCCTGTCGAAGCTGTGAGTTGTATCCGGCTCTCCNATCACATCCTCACATGTTATCTTCAGGTGGGAGTTCAACCTCTTGGGATCACGGTCGTGGCTGTTGTGGAAGGATTTCTCACTCAGCATGGGGACAGTGCTGTGACTCAATTCATGTTCATCCATAAAGATGCGGGCATCTGCCGTCTCCTTCTCGAGGCCCATGGTGCCAACTTTTTTTGTACAAAGTTGGGCATAGAAAAAAGCATTGCCCATCAATTTGTTGCCAACAAAAGGTTCACTATCAGTCCAAATAAATCCTTAATTTGGGGCGAAAAAAAAAAAACTGGCAATCATTTTAAAAGAAACCGTCGCCGGGGCCCGAGGAAAAAAAAAGGGGGCTCCTCTTCCCTGTCTGCGCGTGGTTTTCCGGGGGGGAGGGGGCTTGGGGGGGAAAAGGAGGGTGAAGGGGGAGAAAGCAAACAGGGCCCACCCAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCCGATCCAGCTGAATGT