ORFeome > MGC84457 ORF1 – XORFeome v1.0

MGC84457 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6466534
Gene Page ID:
ORF Xenbase ID: 17261823

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081229
Original XGC clone length: 1020

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ839667
dbEST ID: 79657369
Trimmed Sequence: ATGTCAGATCGAAGCCCCTTTGAAACGGACATGTTAACCCTTACCCGCTATGTCATGGAAAGGGGAAGGCAAGCTAAAGGCACCGGGGAACTGACACAACTTCTGAACTCCATTCTGACTGCTATAAAAGCCATCTCCTCTGCTGTAAGGAAGGCAGGCATTGCACATATGTATGGCATTTCTGGAAGCGTGAATGTGACTGGGGATGAAGTGAAGAAACTGGACGTGTTATCTAATGATCTTGTAATTAACATGCTCAAATCATCCTATGGTACTTGTGCCTTGGTTTCTGAGGAGAACAAAGACGTTATTATCATACCAAAAGATTTACGGGGTAAATACATTGTCTGTTTTGATCCCCTTGATGGTTCTTCTAACATAGACTGCTTAGCATCTATTGGAACAATATTTGCCATATACAGGAAGACAACAGATACAGAGCCCTGTGAAAAAGATGCCCTTCAGCCAGGACGGAACATTGTAGCGGCAGGCTATGCCCTGTATGGAAGTGCAACCCTTGTGGCGCTCTCTACAGGCCAAGGTGTGGATTGCTTCATGCTGGATCCTGCACTTGGAGAATTTGTTTTGGTTGACAAAAATGTGAGAATTAAGAAGAAAGGCAAGATTTACAGTCTTAATGAAGGCTATGCAAAATATTTTGATCCAGCAATAACAGAATACCTACATAATAAGAAATTCCCCCAGGATGGAAGTTCCCATACAGTCCAAGATATGTGGGGTTCAAGTGGTGCTGATGTCAATAAAACCCGGGGTGTTAAGGGGGGGAATTTTTAAGGAATCCGGCCCCATGAAAAAAAAGTCCCTAAAGGA
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGATCGAAGCCCCTTTGAAACGGACATGTTAACCCTTACCCGCTATGTCATGGAAAGGGGAAGGCAAGCTAAAGGCACCGGGGAACTGACACAACTTCTGAACTCCATTCTGACTGCTATAAAAGCCATCTCCTCTGCTGTAAGGAAGGCAGGCATTGCACATATGTATGGCATTTCTGGAAGCGTGAATGTGACTGGGGATGAAGTGAAGAAACTGGACGTGTTATCTAATGATCTTGTAATTAACATGCTCAAATCATCCTATGGTACTTGTGCCTTGGTTTCTGAGGAGAACAAAGACGTTATTATCATACCAAAAGATTTACGGGGTAAATACATTGTCTGTTTTGATCCCCTTGATGGTTCTTCTAACATAGACTGCTTAGCATCTATTGGAACAATATTTGCCATATACAGGAAGACAACAGATACAGAGCCCTGTGAAAAAGATGCCCTTCAGCCAGGACGGAACATTGTAGCGGCAGGCTATGCCCTGTATGGAAGTGCAACCCTTGTGGCGCTCTCTACAGGCCAAGGTGTGGATTGCTTCATGCTGGATCCTGCACTTGGAGAATTTGTTTTGGTTGACAAAAATGTGAGAATTAAGAAGAAAGGCAAGATTTACAGTCTTAATGAAGGCTATGCAAAATATTTTGATCCAGCAATAACAGAATACCTACATAATAAGAAATTCCCCCAGGATGGAAGTTCCCATACAGTCCAAGATATGTGGGGTTCAAGTGGTGCTGATGTCAATAAAACCCGGGGTGTTAAGGGGGGGAATTTTTAAGGAATCCGGCCCCATGAAAAAAAAGTCCCTAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGATCGAAGCCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839666
dbEST ID: 79657368
Trimmed Sequence: GCTGCTTTTTTGGTGTTTCTTAACACAGGCCAAATACTCCTCTACATCATCTGGAGAGCCGAGAATCAGGGGCACCCTCTGATGGATGGTCTCAGGTTGTACATCTAGCACTGGTTGGGTTCCTGTGGTTGCCATCCCTCCAGCCTGCTCTATGATGAAAGACATTGGATTGCACTCGTATAGAAGTCGGAGCTTTCCTTTAGGACTCTTCTCATTGGCTGGATACATAAAAATTCCACCATACACCAGGGTTCTATGGACATCAGCAACCATGGAACCCACATATCTTGAACTGTATGGGGAACTTCCATCCTGGGGGAATTTCTTATTATGTAGGTATTCTGTTATTGCTGGATCAAAATATTTTGCATAGCCTTCATTAAGACTGTAAATCTTGCCTTTCTTCTTAATTCTCACATTTTTGTCAACCAAAACAAATTCTCCAAGTGCAGGATCCAGCATGAAGCAATCCACACCTTGGCCTGTAGAGAGCGCCACAAGGGTTGCACTTCCATACAGGGCATAGCCTGCCGCTACAATGTTCCGTCCTGGCTGAAGGGCATCTTTTTCACAGGGCTCTGTATCTGTTGTCTTCCTGTATATGGCAAATATTGTTCCAATAGATGCCTAGCAGTCTATGTTAAAAGAGCCCATCAGGGGGATCAAAACAGAACAATGTATTTACCCCGTAAATCCTTTGGGTATGAATATTAACGTCTTTTGTTCTCCCTTCAAAAACCAAAGGCCCAAATTAACCAAAAAGGAAAAAAT
Full Trace Sequence: AAAACCGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGCTTTTTTGGTGTTTCTTAACACAGGCCAAATACTCCTCTACATCATCTGGAGAGCCGAGAATCAGGGGCACCCTCTGATGGATGGTCTCAGGTTGTACATCTAGCACTGGTTGGGTTCCTGTGGTTGCCATCCCTCCAGCCTGCTCTATGATGAAAGACATTGGATTGCACTCGTATAGAAGTCGGAGCTTTCCTTTAGGACTCTTCTCATTGGCTGGATACATAAAAATTCCACCATACACCAGGGTTCTATGGACATCAGCAACCATGGAACCCACATATCTTGAACTGTATGGGGAACTTCCATCCTGGGGGAATTTCTTATTATGTAGGTATTCTGTTATTGCTGGATCAAAATATTTTGCATAGCCTTCATTAAGACTGTAAATCTTGCCTTTCTTCTTAATTCTCACATTTTTGTCAACCAAAACAAATTCTCCAAGTGCAGGATCCAGCATGAAGCAATCCACACCTTGGCCTGTAGAGAGCGCCACAAGGGTTGCACTTCCATACAGGGCATAGCCTGCCGCTACAATGTTCCGTCCTGGCTGAAGGGCATCTTTTTCACAGGGCTCTGTATCTGTTGTCTTCCTGTATATGGCAAATATTGTTCCAATAGATGCCTAGCAGTCTATGTTAAAAGAGCCCATCAGGGGGATCAAAACAGAACAATGTATTTACCCCGTAAATCCTTTGGGTATGAATATTAACGTCTTTTGTTCTCCCTTCAAAAACCAAAGGCCCAAATTAACCAAAAAGGAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGCTTTTTTGGTGTTTCTTAAC