ORFeome > MGC85240 ORF1 – XORFeome v1.0

MGC85240 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6253602
Gene Page ID:
ORF Xenbase ID: 17262153

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC081219
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ839784
dbEST ID: 79657486
Trimmed Sequence: ATGTCCTACTCACACCACTTTGTGGATTTCCACGGCTCTAACATCCCCAGCTCCATGAAAAAGCTGGTTGTGACCCAGCTCAGCCCCAACTTCAGGCAGGCTGTTACTCTCATTCCCAACGCCCCGGTGCCAGTGCCAGGGGACGGAGAACTCCTCGTCAGGAACCGCTTTGTAGGAATCAATGCATCGGATATAAACTACTCCTCTGGGCGATATGACATTTCAGTAAAGCCTCCATTTGATGCTGGATTTGAAGGCATTGGGGAAGTTGTAGCTTTGGGCCTCAGTGCTAGTAAAACATACACTGTAGGCCAAACAGTAGCCTATGTTAAAGGTGGCTCATTTGCCGAATATACTGTTGTACCTGCTAAAACTGCAGTCCCAGTACCCTCCGTAAAACCAGAATTCTTAACCCTGCTTATCAGTGGTACAACAGCTTACATCAGTCTCAAGGAGATGGGACAGTTATCTGAAGGAAAAAAGGTTTTGGTGACAGCAGCAGCCGGTGGCACAGGTCAGTTTGCTGTGCAACTTGCAAAGAAAGCTAAATGCTATGTGATTGGGACTTGTTCTTCAGATGAAAAAGCTGGTTTTCTCAATCCATTGGCTGTGATTTTCGGATCATTATAAAACTGAAAATTATGGTTCAGTACTGGAAAATAAGTTTTCTGAATGGTTTAAATGTTGGGTATAAATCGGTTGGGGGGAAAAATGTTTTGACCCAATCATCAACCCTTTGGCCTACAAAAAGGTCGCCCTTAAAATCACCCGGCTTTATTTTCTGGGTAACCAAAAAATTCCCAGGGTCCTTTTTTCCCCTTTTTAAA
Full Trace Sequence: TTCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTACTCACACCACTTTGTGGATTTCCACGGCTCTAACATCCCCAGCTCCATGAAAAAGCTGGTTGTGACCCAGCTCAGCCCCAACTTCAGGCAGGCTGTTACTCTCATTCCCAACGCCCCGGTGCCAGTGCCAGGGGACGGAGAACTCCTCGTCAGGAACCGCTTTGTAGGAATCAATGCATCGGATATAAACTACTCCTCTGGGCGATATGACATTTCAGTAAAGCCTCCATTTGATGCTGGATTTGAAGGCATTGGGGAAGTTGTAGCTTTGGGCCTCAGTGCTAGTAAAACATACACTGTAGGCCAAACAGTAGCCTATGTTAAAGGTGGCTCATTTGCCGAATATACTGTTGTACCTGCTAAAACTGCAGTCCCAGTACCCTCCGTAAAACCAGAATTCTTAACCCTGCTTATCAGTGGTACAACAGCTTACATCAGTCTCAAGGAGATGGGACAGTTATCTGAAGGAAAAAAGGTTTTGGTGACAGCAGCAGCCGGTGGCACAGGTCAGTTTGCTGTGCAACTTGCAAAGAAAGCTAAATGCTATGTGATTGGGACTTGTTCTTCAGATGAAAAAGCTGGTTTTCTCAATCCATTGGCTGTGATTTTCGGATCATTATAAAACTGAAAATTATGGTTCAGTACTGGAAAATAAGTTTTCTGAATGGTTTAAATGTTGGGTATAAATCGGTTGGGGGGAAAAATGTTTTGACCCAATCATCAACCCTTTGGCCTACAAAAAGGTCGCCCTTAAAATCACCCGGCTTTATTTTCTGGGTAACCAAAAAATTCCCAGGGTCCTTTTTTCCCCTTTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTACTCACACCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839783
dbEST ID: 79657485
Trimmed Sequence: AACAGGGATGCTGGCAGACTTTTTCAGTAAGACTGCAGGTAGTGCTCCTGCTTTAACAGGCAAAAGACCTTGAGATGTCTGGTAGCCAGAAATAAAGCCGATGATTATAAGGCGACCTTTTGTAGCCAAACGGTTGACTGATAGGTCAAACATTTCTCCACCAACAGATTCATACACAACATCTAAACCATCAGGAAACTTACTTTTCAGTACTGAACCAATATTTTCAGTTTTATAATTGATTGGAAAATCACAGCCAATGGATTTGAGAAAACCAGCCTTTTCATCTGAAGAACAAGTCCCAATCACATAGCATTTAGCTTTCTTTGCAAGTTGCACAGCAAACTGACCTGTGCCACCGGCTGCTGCTGTCACCAAAACCTTTTTTCCTTCAGATAACTGTCCCATCTCCTTGAGACTGATGTAAGCTGTTGTACCACTGATAAGCAGGGTTAAGAATTCTGGTTTTACGGAGGGTACTGGGACTGCAGTTTTAGCAGGTACAACAGTATATTCGGCAAATGAGCCACCTTTAACATAGGCTACTGTTTGGCCTACAGTGTATGTTTTACTAGCACTGAGGCCCAAAGCTACAACTTCCCCCATGCCTTCAATCCAGCATCAAATGGAGGCTTTTCTGAAATGTCATATCGCCCCAAAGAGTAATTTATATCCCAATGCATTGATTCTTACAAACCGGTTCCTGAACAAGGAGTTCTTCCCTCCCCTGGGCCACTGGCCCCCGGGGGCGTTTGGGGAAAAGAAAAA
Full Trace Sequence: GCAGCTGCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACAGGGATGCTGGCAGACTTTTTCAGTAAGACTGCAGGTAGTGCTCCTGCTTTAACAGGCAAAAGACCTTGAGATGTCTGGTAGCCAGAAATAAAGCCGATGATTATAAGGCGACCTTTTGTAGCCAAACGGTTGACTGATAGGTCAAACATTTCTCCACCAACAGATTCATACACAACATCTAAACCATCAGGAAACTTACTTTTCAGTACTGAACCAATATTTTCAGTTTTATAATTGATTGGAAAATCACAGCCAATGGATTTGAGAAAACCAGCCTTTTCATCTGAAGAACAAGTCCCAATCACATAGCATTTAGCTTTCTTTGCAAGTTGCACAGCAAACTGACCTGTGCCACCGGCTGCTGCTGTCACCAAAACCTTTTTTCCTTCAGATAACTGTCCCATCTCCTTGAGACTGATGTAAGCTGTTGTACCACTGATAAGCAGGGTTAAGAATTCTGGTTTTACGGAGGGTACTGGGACTGCAGTTTTAGCAGGTACAACAGTATATTCGGCAAATGAGCCACCTTTAACATAGGCTACTGTTTGGCCTACAGTGTATGTTTTACTAGCACTGAGGCCCAAAGCTACAACTTCCCCCATGCCTTCAATCCAGCATCAAATGGAGGCTTTTCTGAAATGTCATATCGCCCCAAAGAGTAATTTATATCCCAATGCATTGATTCTTACAAACCGGTTCCTGAACAAGGAGTTCTTCCCTCCCCTGGGCCACTGGCCCCCGGGGGCGTTTGGGGAAAAGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACAGGGATGCTGGCAGA