ORFeome > MGC85304 ORF1 – XORFeome v1.0

MGC85304 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6254351
Gene Page ID:
ORF Xenbase ID: 17262189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078509
Original XGC clone length: 615

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ839697
dbEST ID: 79657399
Trimmed Sequence: ATGTCCGAACGCAAAATACCATTCACCTTCCTCCGCACTCCAAGCTGGGACCCATTTCGGGACTGGTACCAAGGAAGCATTTGCCTTTTTGATCAGTCATTCGGTATGCCACGTATTCCTGAGGACTGGTACCAATGGCCTAGCACCAACTGGCCAGGCTATGTTCGCTTGTTTCCAAGCCAATCCATGGAAGCTGTGCCCCCCATTACACCTGCTGCTGATGCAGCTGCTCCTGACTTCAGTCGTGCCCTCAGCCGACAACTTAGCAGTGGAATCTCAGAGATCCGTCAGACTTCAGACAGATGGAAAATCAGCTTGGATGTCAACCATTTTGCCCCAGAGGAGCTGGTTGTAAAAACTAAAGATGGCATTGTGGAAATCACAGGCAAACATGAAGAGAAACAAGATGAACATGGCTTCGTCTCTAGGTGCTTCACTAGAAAGTACACTCTTCCTCCAGGTGTTGATATAAACGCAGTGGCCTCATCGCTTTCTCCTGATGGCATTTTGACTGTCGAGGCCCCACTACCAAAACCTGCCATTCAGTCTGCAGAGATCAACATCCCAATTGGCACAACCGAGGCTAAGAAAGGGGAGGAGGCTGCCAAGAAATT
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGAACGCAAAATACCATTCACCTTCCTCCGCACTCCAAGCTGGGACCCATTTCGGGACTGGTACCAAGGAAGCATTTGCCTTTTTGATCAGTCATTCGGTATGCCACGTATTCCTGAGGACTGGTACCAATGGCCTAGCACCAACTGGCCAGGCTATGTTCGCTTGTTTCCAAGCCAATCCATGGAAGCTGTGCCCCCCATTACACCTGCTGCTGATGCAGCTGCTCCTGACTTCAGTCGTGCCCTCAGCCGACAACTTAGCAGTGGAATCTCAGAGATCCGTCAGACTTCAGACAGATGGAAAATCAGCTTGGATGTCAACCATTTTGCCCCAGAGGAGCTGGTTGTAAAAACTAAAGATGGCATTGTGGAAATCACAGGCAAACATGAAGAGAAACAAGATGAACATGGCTTCGTCTCTAGGTGCTTCACTAGAAAGTACACTCTTCCTCCAGGTGTTGATATAAACGCAGTGGCCTCATCGCTTTCTCCTGATGGCATTTTGACTGTCGAGGCCCCACTACCAAAACCTGCCATTCAGTCTGCAGAGATCAACATCCCAATTGGCACAACCGAGGCTAAGAAAGGGGAGGAGGCTGCCAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAAACGACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCATCCAGNCTAAAATCCCCCTAAAATAAGTCATATAAAAATGGATCATAACTGGTTTTCCTGGGCAACTCTGGGCCCTGCCACAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGAACGCAAAATACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839696
dbEST ID: 79657398
Trimmed Sequence: TTTCTTGGCAGCCTCCTCCCCTTTCTTAGCCTCGGTTGTGCCAATTGGGATGTTGATCTCTGCAGACTGAATGGCAGGTTTTGGTAGTGGGGCCTCGACAGTCAAAATGCCATCAGGAGAAAGCGATGAGGCCACTGCGTTTATATCAACACCTGGAGGAAGAGTGTACTTTCTAGTGAAGCACCTAGAGACGAAGCCATGTTCATCTTGTTTCTCTTCATGTTTGCCTGTGATTTCCACAATGCCATCTTTAGTTTTTACAACCAGCTCCTCTGGGGCAAAATGGTTGACATCCAAGCTGATTTTCCATCTGTCTGAAGTCTGACGGATCTCTGAGATTCCACTGCTAAGTTGTCGGCTGAGGGCACGACTGAAGTCAGGAGCAGCTGCATCAGCAGCAGGTGTAATGGGGGGCACAGCTTCCATGGATTGGCTTGGAAACAAGCGAACATAGCCTGGCCAGTTGGTGCTAGGCCATTGGTACCAGTCCTCANGAATACGTGGCATACCGAATGACTGATCAAAAAGGCAAATGCTTCCTTGGTACCAGTCCCGAAATGGGTCCCAGCTTGGAGTGCGGAGGAAGGTGAATGGTAATTTGCGTTCGGACATGGTGCCCAACTTTTTGTACAAATTTGCATTTTAAAAAAGCTTGGCTTATCAATTTTGTTGCAAACAAAAAAAACAACAAATAAATCAAAATAAAATTAATTAATTTTGGGGGCCCGAACTTAAAAAAGGGGCGTCTTCATATTAACATCGGCGTCT
Full Trace Sequence: TGCACGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGGCAGCCTCCTCCCCTTTCTTAGCCTCGGTTGTGCCAATTGGGATGTTGATCTCTGCAGACTGAATGGCAGGTTTTGGTAGTGGGGCCTCGACAGTCAAAATGCCATCAGGAGAAAGCGATGAGGCCACTGCGTTTATATCAACACCTGGAGGAAGAGTGTACTTTCTAGTGAAGCACCTAGAGACGAAGCCATGTTCATCTTGTTTCTCTTCATGTTTGCCTGTGATTTCCACAATGCCATCTTTAGTTTTTACAACCAGCTCCTCTGGGGCAAAATGGTTGACATCCAAGCTGATTTTCCATCTGTCTGAAGTCTGACGGATCTCTGAGATTCCACTGCTAAGTTGTCGGCTGAGGGCACGACTGAAGTCAGGAGCAGCTGCATCAGCAGCAGGTGTAATGGGGGGCACAGCTTCCATGGATTGGCTTGGAAACAAGCGAACATAGCCTGGCCAGTTGGTGCTAGGCCATTGGTACCAGTCCTCANGAATACGTGGCATACCGAATGACTGATCAAAAAGGCAAATGCTTCCTTGGTACCAGTCCCGAAATGGGTCCCAGCTTGGAGTGCGGAGGAAGGTGAATGGTAATTTGCGTTCGGACATGGTGCCCAACTTTTTGTACAAATTTGCATTTTAAAAAAGCTTGGCTTATCAATTTTGTTGCAAACAAAAAAAACAACAAATAAATCAAAATAAAATTAATTAATTTTGGGGGCCCGAACTTAAAAAAGGGGCGTCTTCATATTAACATCGGCGTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGGCAGCCTCCTCCCCTT