ORFeome > MGC85389 ORF1 – XORFeome v1.0

MGC85389 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6254338
Gene Page ID:
ORF Xenbase ID: 17262225

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078542
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ839602
dbEST ID: 79657304
Trimmed Sequence: ATGCATCTAGAGATTAAAGTTGGCCTGAATTTCATTATTTCCTACTTGTATAATAAACTACCGAGAAGAAGAGCTGATCTGTTTGGAGAGGAGTTAGAGAGGCTTTTAAAGGGCAAATATGAAGGGCACTGGTACCCAGAGAAACCACTGAAAGGTTCTGGGTATCGCTGTGTTCACATTGGAGAGACTGTTGATCCAGTTGTGGAGCAGGCAGCTCGAAGGAGCGGATTAGATCTAGACGATGTACGCGCAAATGTTCCAGAAGAATTGAGCTTGTGGATTGACCCATTTGAAGTGTCTTATCAGATTGGTGAAAAAGGATCAGTGAAAGTGTTGTACCTTGAAGATGTGGAGAATAGCACTGAGCTAGACAAAGAAATAAAGAGTAGTTTTAACCCAGAGGCACAGGCATTTATCCCGATCACTAATCAGGAAACCTCTTTGTCTAATTCTCCTTCTCCATCATTTGGTCAGTCCCCAAGCCCAACATTCATTCCCCGGGCCACTCAGCCAATGACCTTCACAACGGCNACCTTTGCAGCCACCAAATTTGGCTCAACTAAGATGAAGAAAGGAGGTCAGCGCGTGGCGCGTTCCCCCACTAATAACCTGGTGAAACATAAAGGTCTCTCTTTGTCGATGCATTCGCTAAACTTTAGCCCAGCCCAGGGAGCTCCATCTCAGCTGTCTCCCAATGCCCAGGAGTTTGTTTTTTGGTGGTGCTACTGGGCCTCTTTTTATGATGGGGAACCACCAGAAACCTTTCCAAGCCCCAGGCCCAATTTGCCCTCCTCCCTTTTAACCGGGGGGGAAGCAACCCCTTT
Full Trace Sequence: CGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATCTAGAGATTAAAGTTGGCCTGAATTTCATTATTTCCTACTTGTATAATAAACTACCGAGAAGAAGAGCTGATCTGTTTGGAGAGGAGTTAGAGAGGCTTTTAAAGGGCAAATATGAAGGGCACTGGTACCCAGAGAAACCACTGAAAGGTTCTGGGTATCGCTGTGTTCACATTGGAGAGACTGTTGATCCAGTTGTGGAGCAGGCAGCTCGAAGGAGCGGATTAGATCTAGACGATGTACGCGCAAATGTTCCAGAAGAATTGAGCTTGTGGATTGACCCATTTGAAGTGTCTTATCAGATTGGTGAAAAAGGATCAGTGAAAGTGTTGTACCTTGAAGATGTGGAGAATAGCACTGAGCTAGACAAAGAAATAAAGAGTAGTTTTAACCCAGAGGCACAGGCATTTATCCCGATCACTAATCAGGAAACCTCTTTGTCTAATTCTCCTTCTCCATCATTTGGTCAGTCCCCAAGCCCAACATTCATTCCCCGGGCCACTCAGCCAATGACCTTCACAACGGCNACCTTTGCAGCCACCAAATTTGGCTCAACTAAGATGAAGAAAGGAGGTCAGCGCGTGGCGCGTTCCCCCACTAATAACCTGGTGAAACATAAAGGTCTCTCTTTGTCGATGCATTCGCTAAACTTTAGCCCAGCCCAGGGAGCTCCATCTCAGCTGTCTCCCAATGCCCAGGAGTTTGTTTTTTGGTGGTGCTACTGGGCCTCTTTTTATGATGGGGAACCACCAGAAACCTTTCCAAGCCCCAGGCCCAATTTGCCCTCCTCCCTTTTAACCGGGGGGGAAGCAACCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCTAGAGATTAAAGTTGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839601
dbEST ID: 79657303
Trimmed Sequence: ATTAGCCAGGACAACGGGTTGGAAAGGTTGGCTTGAGTAAGGAAGGTTGAAGTTTAAGCCTTCAACAAAAGGAGATTTCTCTGCAAAAAGGCTGCTCCCACCGGTAAAGGGAGAGGCAAATTGGCCTGGGCTTGGAAGGTTCTGGTTGTCACCATCATAAAAGAGCCCAGTAGCACCACCAAAAACAAACTCCTTGGCATTGGGAGACAGCTGAGATGGAGCTCCCTGGGCTGGGCTAAAGTTTAGCGAATGCATCGACAAAGAGAGACCTTTATGTTTCACCAGGTTATTAGTTGGGGAACGCGCCACGCGCTGACCTCCTTTCTTCATCTTAGTTGAGCCAAATTTGGTGGCTGCAAAGGTTGCCGTTGTGAAGGTCATTGGCTGAGTGGCCCGGGGAATGAATGTTGGGCTTGGGGACTGACCAAATGATGGAGAAGGAGAATTAGACAAAGAGGTTTCCTGATTAGTGATCGGGATAAATGCCTGTGCCTCTGGGTTAAAACTACTCTTTATTTCTTTGTCTAGCTCAGTGCTATTCTCCACATCTTCAAGGTACAACACTTTCACTGATCCTTTTTCACCAATCTGATAAGACACTTTCAATGGGTCAATCCACCAACTCAATTCTTCTGGAACATTTGCGCGTACATCGTCTAGATCTAATCCCCTCCCTTGGACCTCCTGGCCCCACAACGGGATCAACAGTCTCTTCCATGTGAAACACGGCGAATCCCAAGAACCCTTTTACATGGTTTTCCCTGG
Full Trace Sequence: CGTGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTAGCCAGGACAACGGGTTGGAAAGGTTGGCTTGAGTAAGGAAGGTTGAAGTTTAAGCCTTCAACAAAAGGAGATTTCTCTGCAAAAAGGCTGCTCCCACCGGTAAAGGGAGAGGCAAATTGGCCTGGGCTTGGAAGGTTCTGGTTGTCACCATCATAAAAGAGCCCAGTAGCACCACCAAAAACAAACTCCTTGGCATTGGGAGACAGCTGAGATGGAGCTCCCTGGGCTGGGCTAAAGTTTAGCGAATGCATCGACAAAGAGAGACCTTTATGTTTCACCAGGTTATTAGTTGGGGAACGCGCCACGCGCTGACCTCCTTTCTTCATCTTAGTTGAGCCAAATTTGGTGGCTGCAAAGGTTGCCGTTGTGAAGGTCATTGGCTGAGTGGCCCGGGGAATGAATGTTGGGCTTGGGGACTGACCAAATGATGGAGAAGGAGAATTAGACAAAGAGGTTTCCTGATTAGTGATCGGGATAAATGCCTGTGCCTCTGGGTTAAAACTACTCTTTATTTCTTTGTCTAGCTCAGTGCTATTCTCCACATCTTCAAGGTACAACACTTTCACTGATCCTTTTTCACCAATCTGATAAGACACTTTCAATGGGTCAATCCACCAACTCAATTCTTCTGGAACATTTGCGCGTACATCGTCTAGATCTAATCCCCTCCCTTGGACCTCCTGGCCCCACAACGGGATCAACAGTCTCTTCCATGTGAAACACGGCGAATCCCAAGAACCCTTTTACATGGTTTTCCCTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTAGCCAGGACAACGGGTTGGA