ORFeome > MGC85441 ORF1 – XORFeome v1.0

MGC85441 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 942847
Gene Page ID: 942843
ORF Xenbase ID: 17262231

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078561
Original XGC clone length: 333

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ839771
dbEST ID: 79657473
Trimmed Sequence: ATGTCTATGACTGATGTTCTCGCTGCTGCTGACATCAAAAATGCTGTGGGGGCCTTTGCAGCCGCTGACTCATTTAACCACAAGAAATTCTTCGAGTTGGTCGGCCTGAAGAAAAAGAGCGTCGATGACGTCAAAAAAGTCTTCCACATTCTCGACCAGGATCGAAGTGGATTCATAGAAGAGGATGAACTCAAGCTTGTATTAAAAGGATTCACCCCAGATGGCCGCGCTCTCTCTGATAAGGAAACCAAGACACTCCTCGCCGCAGGTGACAAAGATGGAGACGGCAAAATCGGAGTAGATGAATTCACAACACTGGTGGCTGAGTCATT
Full Trace Sequence: CTCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTATGACTGATGTTCTCGCTGCTGCTGACATCAAAAATGCTGTGGGGGCCTTTGCAGCCGCTGACTCATTTAACCACAAGAAATTCTTCGAGTTGGTCGGCCTGAAGAAAAAGAGCGTCGATGACGTCAAAAAAGTCTTCCACATTCTCGACCAGGATCGAAGTGGATTCATAGAAGAGGATGAACTCAAGCTTGTATTAAAAGGATTCACCCCAGATGGCCGCGCTCTCTCTGATAAGGAAACCAAGACACTCCTCGCCGCAGGTGACAAAGATGGAGACGGCAAAATCGGAGTAGATGAATTCACAACACTGGTGGCTGAGTCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCNGATCAAAAAAAAAACAAAAAACAATAAATATTACACCCCCCGAAACCCCGGGAACAAAAAGCCAAAAAAAAATGCACAAAAAGGTGGCCGGGTGTCCCCTGTGTTAAACGGAAAAAGCCCAAAACAAAAGGACAAACCCGTGGGGGTAATCAAGGGTGGAAAAAGGGGGGAGCGCGCCCCGCGGGGGACAAAAACTTAAAAAACCCACGGGGGGGGGAGGAAGGGGGGTGTGTTGTTTTTTTTAAATATTTTTTTTTGTGTATATTTATCTCCTCCGCCCCTCACCCAGAGGCGGCCCCCCCGCGCGGGGTGTGGGTGTTATGAGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTATGACTGATGTTCTCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839770
dbEST ID: 79657472
Trimmed Sequence: TGACTCAGCCACCAGTGTTGTGAATTCATCTACTCCGATTTTGCCGTCTCCATCTTTGTCACCTGCGGCGAGGAGTGTCTTGGTTTCCTTATCAGAGAGAGCGCGGCCATCTGGGGTGAATCCTTTTAATACAAGCTTGAGTTCATCCTCTTCTATGAATCCACTTCGATCCTGGTCGAGAATGTGGAAGACTTTTTTGACGTCATCGACGCTCTTTTTCTTCAGGCCGACCAACTCGAAGAATTTCTTGTGGTTAAATGAGTCAGCGGCTGCAAAGGCCCCCACAGCATTTTTGATGTCAGCAGCAGCGAGAACATCAGTCATAGACATGG
Full Trace Sequence: GACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGACTCAGCCACCAGTGTTGTGAATTCATCTACTCCGATTTTGCCGTCTCCATCTTTGTCACCTGCGGCGAGGAGTGTCTTGGTTTCCTTATCAGAGAGAGCGCGGCCATCTGGGGTGAATCCTTTTAATACAAGCTTGAGTTCATCCTCTTCTATGAATCCACTTCGATCCTGGTCGAGAATGTGGAAGACTTTTTTGACGTCATCGACGCTCTTTTTCTTCAGGCCGACCAACTCGAAGAATTTCTTGTGGTTAAATGAGTCAGCGGCTGCAAAGGCCCCCACAGCATTTTTGATGTCAGCAGCAGCGAGAACATCAGTCATAGACATGGTGCCTACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATAAAGAACGTCAATAAACACTTAGATGACGTGGCGGGATCCGCGGCGACTCAATCCCCCAACTCAAAATAACAAAACGGGGCGTGGGTCTCCCCTTTGGTAGGGGGGAAAGCTCGCCAAAAAAAAAAATCCAAGGGGACCGATTCACAGGTTAGGTAGCGCGCCGGTGCTGCGGGGCCCGAAACCTGACAAAACCCNTTGGAAAAGAAGCAGAGGGGTTCTCCGGTTTTGGAAAATTTTTTTTTGTATGACTTTACCCCCCGGGGCTCCCTAGACAGACAGCTCTCCCCCGGGCCTTTTATGGCGTATGGGAGCCACAAAAAATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGACTCAGCCACCAGTGTT