ORFeome > MGC85443 ORF1 – XORFeome v1.0

MGC85443 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5814634
Gene Page ID: 5814630
ORF Xenbase ID: 17262237

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078562
Original XGC clone length: 786

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ839866
dbEST ID: 79657568
Trimmed Sequence: ATGAGCTGCTCAGAGCATAAGGACTACCATGATGAAGAGTTTGATCCCTGTCATCTCTTTGACATGTACGCTGGGTCTGATAAGACCATTTCTAAGGAGGAGCTGGTGGAAAATCCCATAAAATTTCTCTATAATTTATTGTCATCAGGTTCTGTGAAAGGAGAACTATTGATTGGGCTTACCATTGGCTCTGCTGTTTGGGAAAGCTTTGTTGCTGCTGATTTCTTCAAAAATATTATATTGCTGGAATCTTCAGACTGCTGTATAAAAGCCTTAGAGAATTGGATCAGAAATGAACCTGGAGCTGTGGAACAAGCCCATGTTTTAGAGTTTGTTTGCTCACTTAAAGGGCAAAGTACAGAGTGGAAGAAACAGGAAGAAAAAACCAGAAGGGCAATCAAACAACTGGTAAAATGGGACATCACGAAAGAGAACCCACTGGGTACAGTTGTGTTGCCCCAAGCAGATTGCTTATTTACCATTTATTACTTGGAGGTCATTAGCAAAGATCAAGACATGTATATTAACCTTCTAAAGAAATTTGTGTCCCTTCTGAAGATTGGAGGTCACCTGATCCTGGTAGCAGCGATCAACATGTCTTATTACACGGTCGGCCAGGGCAAGTTTGCTGCTCTAAAGTGCCATTGAAAATTTATACAAAAACCTCTGCCAAAATTGGATGCACCATTGTAAGCTCTGAAACCCACAAAGGGAAATTTAATTCATCTTTTACCCNATTAAAAATCATTTGCCTATTTTTGTTTCCCTTAAAAAACCGGGGGGGGAAGTTGGCCAGATTTTCTTTTGGTACAAAT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTGCTCAGAGCATAAGGACTACCATGATGAAGAGTTTGATCCCTGTCATCTCTTTGACATGTACGCTGGGTCTGATAAGACCATTTCTAAGGAGGAGCTGGTGGAAAATCCCATAAAATTTCTCTATAATTTATTGTCATCAGGTTCTGTGAAAGGAGAACTATTGATTGGGCTTACCATTGGCTCTGCTGTTTGGGAAAGCTTTGTTGCTGCTGATTTCTTCAAAAATATTATATTGCTGGAATCTTCAGACTGCTGTATAAAAGCCTTAGAGAATTGGATCAGAAATGAACCTGGAGCTGTGGAACAAGCCCATGTTTTAGAGTTTGTTTGCTCACTTAAAGGGCAAAGTACAGAGTGGAAGAAACAGGAAGAAAAAACCAGAAGGGCAATCAAACAACTGGTAAAATGGGACATCACGAAAGAGAACCCACTGGGTACAGTTGTGTTGCCCCAAGCAGATTGCTTATTTACCATTTATTACTTGGAGGTCATTAGCAAAGATCAAGACATGTATATTAACCTTCTAAAGAAATTTGTGTCCCTTCTGAAGATTGGAGGTCACCTGATCCTGGTAGCAGCGATCAACATGTCTTATTACACGGTCGGCCAGGGCAAGTTTGCTGCTCTAAAGTGCCATTGAAAATTTATACAAAAACCTCTGCCAAAATTGGATGCACCATTGTAAGCTCTGAAACCCACAAAGGGAAATTTAATTCATCTTTTACCCNATTAAAAATCATTTGCCTATTTTTGTTTCCCTTAAAAAACCGGGGGGGGAAGTTGGCCAGATTTTCTTTTGGTACAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTGCTCAGAGCATAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839865
dbEST ID: 79657567
Trimmed Sequence: CTCCACCCTGTCTTTACGAGACACAAAATAGGCAATTGATTCATAATCGGTTAAAGATGATTTAAATTTCCCTTTGTGTGTTTCAGAGCTTACAATGGTGCATCCAACTTTTGCCAGAGCTTTTCGTATAAACTCTTCATTGCACTTTAGAGCAGCAAACTTGTGTTGGCCGACCGTGTAATAAGACATGTTGATCGCTGCTACCAGGATCAGGTGACCTCCAATCTTCAGAAGGGACACAAATTTCTTTAGAAGGTTAATATACATGTCTTGATCTTTGCTAATGACCTCCAAGTAATAAATGGTAAATAAGCAATCTGCTTGGGGCAACACAACTGTACCCAGTGGGTTCTCTTTCGTGATGTCCCATTTTACCAGTTGTTTGATTGCCCTTCTGGTTTTTTCTTCCTGTTTCTTCCACTCTGTACTTTGCCCTTTAAGTGAGCAAACAAACTCTAAAACATGGGCTTGTTCCACAGCTCCAGGTTCATTTCTGATCCAATTCTCTAAGGCTTTTATACAGCAGTCTGAAGATTCCAGCAATATAATATTTTTGAAGAAATCAGCAGCAACAAAGCTTTCCCAAACAGCAGAGCCGATGGTAAGCCCAATCAATAGTTCTCCTTTCACAGAACCTGATGACAATAATTTATAAAGAATTTTTATGGGGATTTTTCACCAGCTCCCTCCTTAAAAAAGGGTCTTAATCAAACCCCACGTAACATGTTCAAAAAAGATTAACGGGAAACAAAACTCCTTCATCCAGGGGTAATC
Full Trace Sequence: GAAGATGTCTAATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCACCCTGTCTTTACGAGACACAAAATAGGCAATTGATTCATAATCGGTTAAAGATGATTTAAATTTCCCTTTGTGTGTTTCAGAGCTTACAATGGTGCATCCAACTTTTGCCAGAGCTTTTCGTATAAACTCTTCATTGCACTTTAGAGCAGCAAACTTGTGTTGGCCGACCGTGTAATAAGACATGTTGATCGCTGCTACCAGGATCAGGTGACCTCCAATCTTCAGAAGGGACACAAATTTCTTTAGAAGGTTAATATACATGTCTTGATCTTTGCTAATGACCTCCAAGTAATAAATGGTAAATAAGCAATCTGCTTGGGGCAACACAACTGTACCCAGTGGGTTCTCTTTCGTGATGTCCCATTTTACCAGTTGTTTGATTGCCCTTCTGGTTTTTTCTTCCTGTTTCTTCCACTCTGTACTTTGCCCTTTAAGTGAGCAAACAAACTCTAAAACATGGGCTTGTTCCACAGCTCCAGGTTCATTTCTGATCCAATTCTCTAAGGCTTTTATACAGCAGTCTGAAGATTCCAGCAATATAATATTTTTGAAGAAATCAGCAGCAACAAAGCTTTCCCAAACAGCAGAGCCGATGGTAAGCCCAATCAATAGTTCTCCTTTCACAGAACCTGATGACAATAATTTATAAAGAATTTTTATGGGGATTTTTCACCAGCTCCCTCCTTAAAAAAGGGTCTTAATCAAACCCCACGTAACATGTTCAAAAAAGATTAACGGGAAACAAAACTCCTTCATCCAGGGGTAATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCACCCTGTCTTTACGA