ORFeome > MGC85472 ORF1 – XORFeome v1.0

MGC85472 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6254333
Gene Page ID:
ORF Xenbase ID: 17262243

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078574
Original XGC clone length: 819

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ839647
dbEST ID: 79657349
Trimmed Sequence: ATGAGTGGGCGCTACACTCACGCTGTGGTGAGGGGGGTCCCTTCCTCCCTAGCCAAAGAAGCCAATGGGCAGGTAGACCTGGCACGGGCACAGCGTGAGAATGGAGTCTACTGTGGAATCCTGAGACAGAAGCTTGGGCTGCAGGTGGTGGAGTTGCCACCCAATGAAGAACTGCCCCGGGGCCAGTTGATAGGGGACACAGCTGTAGTGATAGCAGATACAGCCCTCATCACCCGCCCATGGATACCTGCAAGGAGGAAAGAGACCGAAGGCCTGCAAAAAATATTTGAGGAGCTGAAATTCCGAGTCTGTGAACTCAATGATGAAAATGCCACTCTGGATGCAAGTGATATACTTTTTACAGGTTCAGAGATTTTTGTAGGCTTGTCTAAATGGACCAATCTTAGAGGTGCTGAAATGGTGGCAAAGACCTACCAGGATTATGCTGTTTCAACTGTTCCAGTGTCTGGGGACTTGCACCTTAAAAGCTTCTGCAGTATGGGGGGACCCAACACCCTGGTCATTGGAAGTAGCGATACAGCCAGAAAGGCACTGAAGACCATGGAACAACTGACCGACCATCACTACGAGACTCTGACTGTTCCTGATGATCCAGCAGCTAACTGCATCTATGCTCGTGTGGGACCTAGATCCAGCGTCCTAATTCACCGCAGCGCGGATGATTACCCCAACAGGGCTTAGGTGGTTCCAAAACCTGAAAGAATACCCTTCTGGTCCCGGCTACTTGTAACGAAATTAACCCAAATCGGGAAGCGTCCCTGAACTTCTTGGCTCTTTTTTATAATAAACCCCCAA
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGGGCGCTACACTCACGCTGTGGTGAGGGGGGTCCCTTCCTCCCTAGCCAAAGAAGCCAATGGGCAGGTAGACCTGGCACGGGCACAGCGTGAGAATGGAGTCTACTGTGGAATCCTGAGACAGAAGCTTGGGCTGCAGGTGGTGGAGTTGCCACCCAATGAAGAACTGCCCCGGGGCCAGTTGATAGGGGACACAGCTGTAGTGATAGCAGATACAGCCCTCATCACCCGCCCATGGATACCTGCAAGGAGGAAAGAGACCGAAGGCCTGCAAAAAATATTTGAGGAGCTGAAATTCCGAGTCTGTGAACTCAATGATGAAAATGCCACTCTGGATGCAAGTGATATACTTTTTACAGGTTCAGAGATTTTTGTAGGCTTGTCTAAATGGACCAATCTTAGAGGTGCTGAAATGGTGGCAAAGACCTACCAGGATTATGCTGTTTCAACTGTTCCAGTGTCTGGGGACTTGCACCTTAAAAGCTTCTGCAGTATGGGGGGACCCAACACCCTGGTCATTGGAAGTAGCGATACAGCCAGAAAGGCACTGAAGACCATGGAACAACTGACCGACCATCACTACGAGACTCTGACTGTTCCTGATGATCCAGCAGCTAACTGCATCTATGCTCGTGTGGGACCTAGATCCAGCGTCCTAATTCACCGCAGCGCGGATGATTACCCCAACAGGGCTTAGGTGGTTCCAAAACCTGAAAGAATACCCTTCTGGTCCCGGCTACTTGTAACGAAATTAACCCAAATCGGGAAGCGTCCCTGAACTTCTTGGCTCTTTTTTATAATAAACCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGGGCGCTACACTCACG

Sequences - 3ʹ (reverse) EST

Accession: JZ839646
dbEST ID: 79657348
Trimmed Sequence: GATTTCTAGCTTGCGGTTTATTAATATAGAGCAAGAAGTCAGGCAGCCTCCGATCTTGGATAATTCTGTACAAGTAGCCGGGACCAGAGTGTAATCTGTCAGTTTCTGGAACACCTGAGCACTGTTGGGGTACTCATCCGCGCTGCGGTGAATTAGGACGCTGGATTTAGGTCCCACACGAGCATAGATGCAGTTAGCTGCTGGATCATCAGGAACAGTCAGAGTCTCGTAGTGATGGTCGGTCAGTTGTTCCATGGTCTTCAGTGCCTTTCTGGCTGTATCGCTACTTCCAATGACCAGGGTGTTGGGTCCCCCCATACTGCAGAAGCTTTTAAGGTGCAAGTCCCCAGACACTGGAACAGTTGAAACAGCATAATCCTGGTAGGTCTTTGCCACCATTTCAGCACCTCTAAGATTGGTCCATTTAGACAAGCCTACAAAAATCTCTGAACCTGTAAAAAGTATATCACTTGCATCCAGAGTGGCATTTTCATCATTGAGTTCACAGACTCGGAATTTCAGCTCCTCAAATATTTTTTGCAGGCCTTCGGTCTCTTTCCTCCTTGCAAGTATCCATGGGGCGGGTGATGAGGGGCTGTATCTGCTATCACTAACAGCTGTGTCCCCTATCAACTGGCCCCGGGGCAGTTCCTTCTTGGGGTGGCAACTCCACCACCCGGCACCCCCAAGCTTCTTGTCTCAGGGAATCCCACATTAAAACTCCATTTCCCAACCCTGGTGCCCCCGTTGCCAAGGGTTTAACCTGGCCCCAATT
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTTCTAGCTTGCGGTTTATTAATATAGAGCAAGAAGTCAGGCAGCCTCCGATCTTGGATAATTCTGTACAAGTAGCCGGGACCAGAGTGTAATCTGTCAGTTTCTGGAACACCTGAGCACTGTTGGGGTACTCATCCGCGCTGCGGTGAATTAGGACGCTGGATTTAGGTCCCACACGAGCATAGATGCAGTTAGCTGCTGGATCATCAGGAACAGTCAGAGTCTCGTAGTGATGGTCGGTCAGTTGTTCCATGGTCTTCAGTGCCTTTCTGGCTGTATCGCTACTTCCAATGACCAGGGTGTTGGGTCCCCCCATACTGCAGAAGCTTTTAAGGTGCAAGTCCCCAGACACTGGAACAGTTGAAACAGCATAATCCTGGTAGGTCTTTGCCACCATTTCAGCACCTCTAAGATTGGTCCATTTAGACAAGCCTACAAAAATCTCTGAACCTGTAAAAAGTATATCACTTGCATCCAGAGTGGCATTTTCATCATTGAGTTCACAGACTCGGAATTTCAGCTCCTCAAATATTTTTTGCAGGCCTTCGGTCTCTTTCCTCCTTGCAAGTATCCATGGGGCGGGTGATGAGGGGCTGTATCTGCTATCACTAACAGCTGTGTCCCCTATCAACTGGCCCCGGGGCAGTTCCTTCTTGGGGTGGCAACTCCACCACCCGGCACCCCCAAGCTTCTTGTCTCAGGGAATCCCACATTAAAACTCCATTTCCCAACCCTGGTGCCCCCGTTGCCAAGGGTTTAACCTGGCCCCAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTTCTAGCTTGCGGTTTATTAA