ORFeome > MGC85513 ORF1 – XORFeome v1.0

MGC85513 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 968514
Gene Page ID: 968507
ORF Xenbase ID: 17262255

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078588
Original XGC clone length: 624

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ839820
dbEST ID: 79657522
Trimmed Sequence: ATGGCCCGGTTGCTCCCCGTCCTCCTCGCGCTGCTCTTTTGCGGCTACGTGCGGCCCATCTCTTTTTCATTGCCGCCAAACAGCCGCAAGTGTTTGCAAAAAAAAATTCACAAAAACGTGCTTGTGACTGGAAAGTACAAGCTGTCTGAGGCCCACAATCAGGGCCAAGTGCGGCTAAAAATTACAAACTCTGCTGGGCACATTCTCTACTCCAAGGAAAATGCTTCCAAGGGCAAGTTTGCTTTCACCACTGAGGAGTATGACATGTTTGAGGTCTGCTTCAATAGTAAGCTACCAGCAGGTGCTGGCCGAGTACCAAATCAGTTGGTGAATCTCATTATGAAGCATGGAGTAAAGGCAAAAAATTATGAAAAAATTGCAAAGGTGGAAAAACTTAAACCACTCAAGGTTGAACTTCGGCGTCTTGAGGATTTGTCTGAGTCTATCGTCAATGATTTTGCCTACATGAAAAAAAGAGAGGAAAAAATGAGGGACACAAATGAATCCACCAATGTACGTGTTCTTTACTTCAGCATTTTCTCTATGTGTTGCCTAATGGGACTGGCCACCTGGCAAGTTTTCTATCTCCGCCGTTTCTTTAAAGCAAAAAACTAATGGAATTGCAAACTTTTCTTGAAAAAGTTGGCATTTAAAAAAAAACATTGCTTATCAATTTGTTTGCACCAAACAGGTACATACCATTAAAAAAAAATCATTAATTTCCACCCCCCTAAAATCCCCTAAATTGGATCAAAAAAAAATGGGTCCTAAACATAATTAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GCTCGAGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCGGTTGCTCCCCGTCCTCCTCGCGCTGCTCTTTTGCGGCTACGTGCGGCCCATCTCTTTTTCATTGCCGCCAAACAGCCGCAAGTGTTTGCAAAAAAAAATTCACAAAAACGTGCTTGTGACTGGAAAGTACAAGCTGTCTGAGGCCCACAATCAGGGCCAAGTGCGGCTAAAAATTACAAACTCTGCTGGGCACATTCTCTACTCCAAGGAAAATGCTTCCAAGGGCAAGTTTGCTTTCACCACTGAGGAGTATGACATGTTTGAGGTCTGCTTCAATAGTAAGCTACCAGCAGGTGCTGGCCGAGTACCAAATCAGTTGGTGAATCTCATTATGAAGCATGGAGTAAAGGCAAAAAATTATGAAAAAATTGCAAAGGTGGAAAAACTTAAACCACTCAAGGTTGAACTTCGGCGTCTTGAGGATTTGTCTGAGTCTATCGTCAATGATTTTGCCTACATGAAAAAAAGAGAGGAAAAAATGAGGGACACAAATGAATCCACCAATGTACGTGTTCTTTACTTCAGCATTTTCTCTATGTGTTGCCTAATGGGACTGGCCACCTGGCAAGTTTTCTATCTCCGCCGTTTCTTTAAAGCAAAAAACTAATGGAATTGCAAACTTTTCTTGAAAAAGTTGGCATTTAAAAAAAAACATTGCTTATCAATTTGTTTGCACCAAACAGGTACATACCATTAAAAAAAAATCATTAATTTCCACCCCCCTAAAATCCCCTAAATTGGATCAAAAAAAAATGGGTCCTAAACATAATTAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCGGTTGCTCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839819
dbEST ID: 79657521
Trimmed Sequence: TTCAATTAGTTTTTTGGCCTTAAAGAAACGGCGGAGATAGAAAACTTGCCAGGTGGCCAGTCCCATTAGGCAACACATAGAGAAAATGCTGAAGTAAAGAACACGTACATTGGTGGATTCATTTGTGTCCCTCATTTCTTCCTCTCTCTTTTTCATGTAGGCAAAATCATTGACGATAGACTCAGACAAATCCTCAAGACGCCGAAGTTCAACCTCGAGTGGTTTAAGTTTCTCCACCTTTGCAATCTCTTCATAATTTTTTGCCTCTACTCCATGCTTCATAATGAGATTCACCAACTGATCTGGTACTCGGCCAGCACCTGCTGGTAGCTTACTATCGAAGCAGACCTCANACATGTCATACTCCTCAGTGGTGAAAGCAAACTTGCCCTTGGAAGCATCTTCCTTGGAGTAGAGAATGTGCCCAGCAGAGTCTGTAATCTTTAGCCGCACTTGGCCCTGATTGTGGGCCTCAGACAGCTCGTACTCTCCAGTCACAAGCACGTTCTTGTGAATTTCTTCTCGCAAACACTTGGCGGCTGTTTGGCGGCAATGAAAAAAAGATGGGCCGCACGTAGCCCCCAAAGACCAGCGCCAAGGAGGACGGGGAGCAACCGGGCCATGGTGCCAACCTTTTTTGGACAAATTTGGCAATTATAAAAAACATTGCTCATTAATTTGTTGCAACAAAAGGGGTCCCGATTAACTTAAAAAAAAAAAACCATTTAATTATAAGGACCCAAACATAAAAAAAAGGGCCGCTT
Full Trace Sequence: GAAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAATTAGTTTTTTGGCCTTAAAGAAACGGCGGAGATAGAAAACTTGCCAGGTGGCCAGTCCCATTAGGCAACACATAGAGAAAATGCTGAAGTAAAGAACACGTACATTGGTGGATTCATTTGTGTCCCTCATTTCTTCCTCTCTCTTTTTCATGTAGGCAAAATCATTGACGATAGACTCAGACAAATCCTCAAGACGCCGAAGTTCAACCTCGAGTGGTTTAAGTTTCTCCACCTTTGCAATCTCTTCATAATTTTTTGCCTCTACTCCATGCTTCATAATGAGATTCACCAACTGATCTGGTACTCGGCCAGCACCTGCTGGTAGCTTACTATCGAAGCAGACCTCANACATGTCATACTCCTCAGTGGTGAAAGCAAACTTGCCCTTGGAAGCATCTTCCTTGGAGTAGAGAATGTGCCCAGCAGAGTCTGTAATCTTTAGCCGCACTTGGCCCTGATTGTGGGCCTCAGACAGCTCGTACTCTCCAGTCACAAGCACGTTCTTGTGAATTTCTTCTCGCAAACACTTGGCGGCTGTTTGGCGGCAATGAAAAAAAGATGGGCCGCACGTAGCCCCCAAAGACCAGCGCCAAGGAGGACGGGGAGCAACCGGGCCATGGTGCCAACCTTTTTTGGACAAATTTGGCAATTATAAAAAACATTGCTCATTAATTTGTTGCAACAAAAGGGGTCCCGATTAACTTAAAAAAAAAAAACCATTTAATTATAAGGACCCAAACATAAAAAAAAGGGCCGCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAATTAGTTTTTTGGCCTT