ORFeome > micu2 ORF1 – XORFeome v1.0

micu2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: micu2
Gene ID: 994928
Gene Page ID: 994924
ORF Xenbase ID: 17284089

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097898
Original XGC clone length: 1293

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ838381
dbEST ID: 79656083
Trimmed Sequence: ATGGCCGCTTGGAGAGCAGTATTCCCAGTTCTGTTGCGGAGATTGGGGACTGTAGGACCTGGAAGGGGCAGAAGGTCAGTCAGTGCAGTCCGACTTGTAGGAGCTGGTCTGGCCGTTGCAGGGACGGTGTGTTCCGGTGCGCTGCTCCTCACAGGGACGAAGCTACGAGGGATTGAACGGCTGACGGTGTTGGCACAGAAAGAAGATGCCAATGATGAAGCAAACTGGAAAAAGTCCATTCTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGCTTGGAGAGCAGTATTCCCAGTTCTGTTGCGGAGATTGGGGACTGTAGGACCTGGAAGGGGCAGAAGGTCAGTCAGTGCAGTCCGACTTGTAGGAGCTGGTCTGGCCGTTGCAGGGACGGTGTGTTCCGGTGCGCTGCTCCTCACAGGGACGAAGCTACGAGGGATTGAACGGCTGACGGTGTTGGCACAGAAAGAAGATGCCAATGATGAAGCAAACTGGAAAAAGTCCATTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATACTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTGGCAGCGTCTCTGGTGTTTCATTNCGGTNTGTGCCACTGTGGCTNGCCTTTGTGCTGTTTCCGCTGGCTCTTCGGCGTGGGCTGGGTGGTTGTTGGGGGCGCCTTTCCCTCGGCCCCCCCGCTCCTGGCTCGTGTGTGGTCTTCTTCGTGGGTGGTCTGCGCGGGGGGGGCCCCTTCCCCCGCTCCTCGTCCCCGCTCCCCGGTGCCCGTTCTTGTTGTTCCTCTTGGGGGGGGCGTCCGGCCGCCGGGTCGCCCCCCTGGGTTTTGCTCTGCGGGGGCTTTGTTTCGTCGCGCTGCCTCTGTTTGGTCCGCGGGTGGTCCCCTTGGTTCGTGGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCTTGGAGAGCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838380
dbEST ID: 79656082
Trimmed Sequence: GAATGGACTTTTTCCAGTTTGCTTCATCATTGGCATCTTCTTTCTGTGCCAACACCGTCAGCCGTTCAATCCCTCGTAGCTTCGTCCCTGTGAGGAGCAGCGCACCGGAACACACCGTCCCTGCAACGGCCAGACCAGCTCCTACAAGTCGGACTGCACTGACTGACCTTCTGCCCCTTCCAGGTCCTACAGTCCCCAATCTCCGCAACAGAACTGGGAATACTGCTCTCCAAGCGGCCATGG
Full Trace Sequence: GGGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAANAAAGTTGGCAAGAATGGACTTTTTCCAGTTTGCTTCATCATTGGCATCTTCTTTCTGTGCCAACACCGTCAGCCGTTCAATCCCTCGTAGCTTCGTCCCTGTGAGGAGCAGCGCACCGGAACACACCGTCCCTGCAACGGCCAGACCAGCTCCTACAAGTCGGACTGCACTGACTGACCTTCTGCCCCTTCCAGGTCCTACAGTCCCCAATCTCCGCAACAGAACTGGGAATACTGCTCTCCAAGCGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGTCGCATTTCGCGTCGTGAATGGGNNGGNGGGGGGGGGAAAGNGGNGTTGTCNCGNGGCCTCGGCGTTTTGTGNTTGNGGNGTTTTTTTNTGTTGGTGGGTGGGGGNGGTGNGNNNGTGTGGGTGGGGGTGGGNGNTGGGGTTGGTGTGGGGGGNNNNGNGNGGGGGNNNGNGCGGGGGNCNGGGGCTGTTGNTGCNNNCTGGTGNNGCCGGGGGGGGGGGGNTCNGGTGGGGGTGGNNGGGGNGGGGGNGGNNGGGTGGTCGGGNGGGGGTGGGGGGGGNNGTGTGTGGNNGGGGGTGNCGGNNTGTNNGGGGGGGGNNNGGGGTGGGGGNGNNGNGCGGGGCGGGGGGGGGGGGGGNTNNNTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAATGGACTTTTTCCAGTTTGCTT