ORFeome > midn ORF1 – XORFeome v1.0

midn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: midn
Gene ID: 1005239
Gene Page ID: 1005231
ORF Xenbase ID: 17284095

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046865
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ823567
dbEST ID: 79641269
Trimmed Sequence: ATGGAGCAGCAGCCCAGTGTCCCACGGAGCTGCACTAACGTAGCTCGAGAAACGCCCATGAACCTTAATATTCAGAGCACCACTGGCACCCGTTATGAGCTGTCCGTGCCGCCGGACGAGACCGTAGATGGACTAAAGCGACGAATCTCGCAGCGGCTCAAGGTGCCAAAGGATAGGCTCACCCTGTTGCACCGGGAGACGCGCCTGAGCTCGGGAAAACTGCAAGATTTGGGGATATCCGATGGCAGCAGACTAACCCTGCTGCCAAGTGTAGAGGCTGGATTAATGTCCCAGATGTCCCGCCCTGAGCAGTCTGTAATGCAGGCCCTGGAGAGCTTGACGGAGACGCAGGTGAATGATTTCCTATCTGGCCGTTCTCCTCTTACACTAGCGCTACGTGTTGGTGATCATATGATGTTTGTGCAACTCCAGTTGGCTGCTCAACAATCAGGGAGTTCTCACCTCCAACACCGGCATGTAATCACCAGAGGAGCTGAGACTAGTGCATCCCCACAGTACCGCACCTTACATACAAGCACGTCTGCTGTTTCACATTTGGCAAGTTGCACACCGGGCCCTACTCCCCCCACTACTTTGTCTCCAACTTCTTCCACACACTGCAATGGCCCCCATTCTTCTCCCCTCACCACAAGCGTCTTCCGTTCCCATGGAGAAAGTGTGGCTGTGTCACCCTGT
Full Trace Sequence: GGACAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCAGCCCAGTGTCCCACGGAGCTGCACTAACGTAGCTCGAGAAACGCCCATGAACCTTAATATTCAGAGCACCACTGGCACCCGTTATGAGCTGTCCGTGCCGCCGGACGAGACCGTAGATGGACTAAAGCGACGAATCTCGCAGCGGCTCAAGGTGCCAAAGGATAGGCTCACCCTGTTGCACCGGGAGACGCGCCTGAGCTCGGGAAAACTGCAAGATTTGGGGATATCCGATGGCAGCAGACTAACCCTGCTGCCAAGTGTAGAGGCTGGATTAATGTCCCAGATGTCCCGCCCTGAGCAGTCTGTAATGCAGGCCCTGGAGAGCTTGACGGAGACGCAGGTGAATGATTTCCTATCTGGCCGTTCTCCTCTTACACTAGCGCTACGTGTTGGTGATCATATGATGTTTGTGCAACTCCAGTTGGCTGCTCAACAATCAGGGAGTTCTCACCTCCAACACCGGCATGTAATCACCAGAGGAGCTGAGACTAGTGCATCCCCACAGTACCGCACCTTACATACAAGCACGTCTGCTGTTTCACATTTGGCAAGTTGCACACCGGGCCCTACTCCCCCCACTACTTTGTCTCCAACTTCTTCCACACACTGCAATGGCCCCCATTCTTCTCCCCTCACCACAAGCGTCTTCCGTTCCCATGGAGAAAGTGTGGCTGTGTCACCCTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCAGCCCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828865
dbEST ID: 79646567
Trimmed Sequence: TGCCACCACAAACTCTGAGTTCAGTTCAGCCTTGACATCCGGCTTCCACAGAGAGTCCTCAAAGTCAATCTCCAGGCTGCCCTCCCCACTAGATGTACTGCTGTTACTGCTGGTCCGACTAGATTTTCGAGTGGGCATCCAATGATATGGAGCCCTTGAGTCTCTTCTTGCCTTCCTGCGCAACCTCTTTTGATGCATAAGCAGTTGCAAACGCTCCACTTTGCACCGAGTCGCCCTATTTTCCGTCTGACGCAAACGGTCTCCACTTGGTTTATATGTGCGGGTCTGAGTCTGGCAATGGCCTACTGGATGAGTGGTTTGCTGGGGAGAGGTGCTTTGGGGAGAGGTAGCTTTAGCATTCCTTGCCTGGGATGCACACTGGGTGTGACATCGGAGTGTTGTTAGAGACGGTGGCATACCCTGGTAGTGACGGGTGGCACTCAACAGATCATTTAGAATCTGTAAGATGGTCCCGATATCCCTGCGGGGACGACCTGCACTGTCCTGGCACTGTGGATGCAAGGTGCCAGAAAATGTCCCTGAGAAAACACCAGGAGCATGGTTGACAAAGCTCTCAATAATCGCACCAGGTTTCCGGGATCTGCTGGATGGTGAAGAGCTTGTTCCCTCAGTTCCTCTAGTACTGCATGGTGCC
Full Trace Sequence: CTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCCACCACAAACTCTGAGTTCAGTTCAGCCTTGACATCCGGCTTCCACAGAGAGTCCTCAAAGTCAATCTCCAGGCTGCCCTCCCCACTAGATGTACTGCTGTTACTGCTGGTCCGACTAGATTTTCGAGTGGGCATCCAATGATATGGAGCCCTTGAGTCTCTTCTTGCCTTCCTGCGCAACCTCTTTTGATGCATAAGCAGTTGCAAACGCTCCACTTTGCACCGAGTCGCCCTATTTTCCGTCTGACGCAAACGGTCTCCACTTGGTTTATATGTGCGGGTCTGAGTCTGGCAATGGCCTACTGGATGAGTGGTTTGCTGGGGAGAGGTGCTTTGGGGAGAGGTAGCTTTAGCATTCCTTGCCTGGGATGCACACTGGGTGTGACATCGGAGTGTTGTTAGAGACGGTGGCATACCCTGGTAGTGACGGGTGGCACTCAACAGATCATTTAGAATCTGTAAGATGGTCCCGATATCCCTGCGGGGACGACCTGCACTGTCCTGGCACTGTGGATGCAAGGTGCCAGAAAATGTCCCTGAGAAAACACCAGGAGCATGGTTGACAAAGCTCTCAATAATCGCACCAGGTTTCCGGGATCTGCTGGATGGTGAAGAGCTTGTTCCCTCAGTTCCTCTAGTACTGCATGGTGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCACCACAAACTCTGA