ORFeome > midn ORF2 – XORFeome v1.0

midn ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: midn
Gene ID: 6256089
Gene Page ID: 1005231
ORF Xenbase ID: 17284101

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046658
Original XGC clone length: 1356

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ823853
dbEST ID: 79641555
Trimmed Sequence: ATGGAGCAGCAGCCTAGTGTCCCGCGGAGCTGCACCAACGTAGCTCGAGAAACGCCCATGAACCTTAATATTCAGAGCACCACTGGCACCCGCTATGAGCTGTCCGTACCGCTCAACGAGACCGTGGATGGACTAAAGCGACGAATCTCGCAGCGGCTCAAGGTGCCGAAGGAGAGGCTCACCCTGTTGCACCGGGAGACGCGCCTGAGCTCGGGAAAACTGCAAGATTTGGGGATATCAGATGGCAGCAGACTAACCCTGCTGCCAAGCGTAGAAGCTGGACTAATGTCCCAGATGTCCCGTCCTGAGCAGTCTGTAATGCAGGCCCTGGAGAGTTTGACGGAGACGCAGGTGAATGATTTCCTATCTGGCCGTTCCCCTCTTACGCTAGCACTACGTGTTGGTGATCATATGATGTTTGTGCAACTCCAGTTGGCTGCTCAACAGTCAGGGGGTTCTCACCTCCAACACCGGCATGTAATCACCAGAGGAGCTGACGCTGGTGCACCCCCACAATACCGCACCTTACATACAAGCACGTCTGCTCTTTCCCATTTGGCAAGTTGCACACCAGGCTCTACTCCACCCACTACGTTGTCTCCAACTTCTTCCACACACTGCGATGCCCCCCATTCGTCTCCCCTTACCACAAGCGTCTTCCGTTCCCACGGAGAAGGAGTGTCACCCTGTGCAGAGCAGGTACCATGCAGTACTAGAGGAACTGAGGGGACAAGCTCTTTCACATCAAGCAGATCCCGGGAAGCCCGGGTGCGAATTATGGAGAAGCTTTGTCAACCCACCCCTCCCGGGGGGTTTTTTTCCAGGGGAAAA
Full Trace Sequence: ATGGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCAGCCTAGTGTCCCGCGGAGCTGCACCAACGTAGCTCGAGAAACGCCCATGAACCTTAATATTCAGAGCACCACTGGCACCCGCTATGAGCTGTCCGTACCGCTCAACGAGACCGTGGATGGACTAAAGCGACGAATCTCGCAGCGGCTCAAGGTGCCGAAGGAGAGGCTCACCCTGTTGCACCGGGAGACGCGCCTGAGCTCGGGAAAACTGCAAGATTTGGGGATATCAGATGGCAGCAGACTAACCCTGCTGCCAAGCGTAGAAGCTGGACTAATGTCCCAGATGTCCCGTCCTGAGCAGTCTGTAATGCAGGCCCTGGAGAGTTTGACGGAGACGCAGGTGAATGATTTCCTATCTGGCCGTTCCCCTCTTACGCTAGCACTACGTGTTGGTGATCATATGATGTTTGTGCAACTCCAGTTGGCTGCTCAACAGTCAGGGGGTTCTCACCTCCAACACCGGCATGTAATCACCAGAGGAGCTGACGCTGGTGCACCCCCACAATACCGCACCTTACATACAAGCACGTCTGCTCTTTCCCATTTGGCAAGTTGCACACCAGGCTCTACTCCACCCACTACGTTGTCTCCAACTTCTTCCACACACTGCGATGCCCCCCATTCGTCTCCCCTTACCACAAGCGTCTTCCGTTCCCACGGAGAAGGAGTGTCACCCTGTGCAGAGCAGGTACCATGCAGTACTAGAGGAACTGAGGGGACAAGCTCTTTCACATCAAGCAGATCCCGGGAAGCCCGGGTGCGAATTATGGAGAAGCTTTGTCAACCCACCCCTCCCGGGGGGTTTTTTTCCAGGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCAGCCTAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829161
dbEST ID: 79646863
Trimmed Sequence: TGCCACCACAAACTCTGAGTTCAATTCAGCCTTGACATCCGGTTTCCACAGAGAGTCCTCAAAGTCAATCTCCAGGCTGCCCTCCCCACTAGATGTACTGCTGTTACTGCTGGTCCGACTAGATTTTCGGGTGGGCATCCAATGATATGGAGCCCTTGAGTCTCTCCTTGCCTTCCTGCGCAATCTCTTCTGATGCATGAGCAGCTGCAATCGCTCAACTTTGCATCGAGTCGCCCTATTTTCAGTCTGTCGCAAGCGGTCTCCACTTGGTTTGCATGTGCGGGTCTGAGCCTGACAATGGCCTACTGGATGAGTGGTTTGCTGGGGTCCCGTGCTTTGGGGAGAGGTAGCTTTAGCATTCCTGGCCTGGGATGCACACTGGGTGTGACATCGGAGTGTGGTTAGAGACGGTGGCATACCCTGGTAGTGACGGGTGGCACTCAACAGATCATTTAGAATCTGTAAGATGGTGCCAATATCCCGGCGGGGACGACCTGCACCGTCTTGGCAATGTGGATGCAAAGTGCCAGAAAATGTCCCTGAGAAAACACCAGGAGCGTGGTTGACAAAGCTCTCAATAATCGCACCGGGCTTCCGGGATCTGCTTGATGGTGAAGAGCTTGTTTCCTCAGTTCCTCTAGTACTGCATGGTACCTGCTCTGCACAGGGTGACACTCCTTCTTCCTTGGGAAACGGAGAACGCTTGTTGGTAAGGGGAAAACAATGGGGGGGGCATCCCCAGTGGGGTGGAAAAAAATTTGGAAAAAAACAAAAAAA
Full Trace Sequence: CCGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCCACCACAAACTCTGAGTTCAATTCAGCCTTGACATCCGGTTTCCACAGAGAGTCCTCAAAGTCAATCTCCAGGCTGCCCTCCCCACTAGATGTACTGCTGTTACTGCTGGTCCGACTAGATTTTCGGGTGGGCATCCAATGATATGGAGCCCTTGAGTCTCTCCTTGCCTTCCTGCGCAATCTCTTCTGATGCATGAGCAGCTGCAATCGCTCAACTTTGCATCGAGTCGCCCTATTTTCAGTCTGTCGCAAGCGGTCTCCACTTGGTTTGCATGTGCGGGTCTGAGCCTGACAATGGCCTACTGGATGAGTGGTTTGCTGGGGTCCCGTGCTTTGGGGAGAGGTAGCTTTAGCATTCCTGGCCTGGGATGCACACTGGGTGTGACATCGGAGTGTGGTTAGAGACGGTGGCATACCCTGGTAGTGACGGGTGGCACTCAACAGATCATTTAGAATCTGTAAGATGGTGCCAATATCCCGGCGGGGACGACCTGCACCGTCTTGGCAATGTGGATGCAAAGTGCCAGAAAATGTCCCTGAGAAAACACCAGGAGCGTGGTTGACAAAGCTCTCAATAATCGCACCGGGCTTCCGGGATCTGCTTGATGGTGAAGAGCTTGTTTCCTCAGTTCCTCTAGTACTGCATGGTACCTGCTCTGCACAGGGTGACACTCCTTCTTCCTTGGGAAACGGAGAACGCTTGTTGGTAAGGGGAAAACAATGGGGGGGGCATCCCCAGTGGGGTGGAAAAAAATTTGGAAAAAAACAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCACCACAAACTCTGA