ORFeome > mitd1 ORF1 – XORFeome v1.0

mitd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mitd1
Gene ID: 6078869
Gene Page ID: 5755251
ORF Xenbase ID: 17284179

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097919
Original XGC clone length: 561

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ838437
dbEST ID: 79656139
Trimmed Sequence: ATGGATCGAGCTGAAGAAATAAAACAGCATGTGCTCAAAGAGAAAGAAGAGGGAAAATACCACAAGCAAATAAAAATTTTAGAAAATGCAACAGGTTACAGCTATGAAAATCTTTTCAAACCTTATGTGAATGAAACCTTAACAGAGGTGTGGGTGGAAGATCCTTACATCCGGTATGTGCATCAGTTATACAACTTTTTACGTTTCTGTGAAATGCTTATAAAGGGACCTTCCAAGGTAAAGAAAATCAACTTACTGACCTCCATGGATGAAGATAATGGAAAAGCCCTACAAGCCAGTGGCCTTCAAGAAATCAAAAGTTCATTGCATGATTATGGTGTAATACTTGAGGTCACATTTTCCTCTTCTATTCATGACCGGGAAATTAGGTTCAACAATGGTTGGATGATCAAGATTGGACGAGGTTTAGACTACTTCAAAAAGCCTCAGGGTCGGTTTTCTATAGGCTACTGTGATTTTGACTTAAGGCCGTGCTATGAAACATCTGTGGACATTTTCCATAATAATCACACTCGCAATGGAACCAGACTCACAATCTT
Full Trace Sequence: TCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCGAGCTGAAGAAATAAAACAGCATGTGCTCAAAGAGAAAGAAGAGGGAAAATACCACAAGCAAATAAAAATTTTAGAAAATGCAACAGGTTACAGCTATGAAAATCTTTTCAAACCTTATGTGAATGAAACCTTAACAGAGGTGTGGGTGGAAGATCCTTACATCCGGTATGTGCATCAGTTATACAACTTTTTACGTTTCTGTGAAATGCTTATAAAGGGACCTTCCAAGGTAAAGAAAATCAACTTACTGACCTCCATGGATGAAGATAATGGAAAAGCCCTACAAGCCAGTGGCCTTCAAGAAATCAAAAGTTCATTGCATGATTATGGTGTAATACTTGAGGTCACATTTTCCTCTTCTATTCATGACCGGGAAATTAGGTTCAACAATGGTTGGATGATCAAGATTGGACGAGGTTTAGACTACTTCAAAAAGCCTCAGGGTCGGTTTTCTATAGGCTACTGTGATTTTGACTTAAGGCCGTGCTATGAAACATCTGTGGACATTTTCCATAATAATCACACTCGCAATGGAACCAGACTCACAATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCTCCCACCTGATATCCCCTATAATTGAGTCGTATTACATGGTCCTAAACTGAAAAACGGAAAAAAAAAAGACAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCGAGCTGAAGAAATAAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838436
dbEST ID: 79656138
Trimmed Sequence: GATTGTGAGTCTGGTTCCATTGCGAGTGTGATTATTATGGAAAATGTCCACAGATGTTTCATAGCACGGCCTTAAGTCAAAATCACAGTAGCCTATAGAAAACCGACCCTGAGGCTTTTTGAAGTAGTCTAAACCTCGTCCAATCTTGATCATCCAACCATTGTTGAACCTAATTTCCCGGTCATGAATAGAAGAGGAAAATGTGACCTCAAGTATTACACCATAATCATGCAATGAACTTTTGATTTCTTGAAGGCCACTGGCTTGTAGGGCTTTTCCATTATCTTCATCCATGGAGGTCAGTAAGTTGATTTTCTTTACCTTGGAAGGTCCCTTTATAAGCATTTCACAGAAACGTAAAAAGTTGTATAACTGATGCACATACCGGATGTAAGGATCTTCCACCCACACCTCTGTTAAGGTTTCATTCACATAAGGTTTGAAAAGATTTTCATAGCTGTAACCTGTTGCATTTTCTAAAATTTTTATTTGCTTGTGGTATTTTCCCTCTTCTTTCTCTTTGAGCACATGCGGGTTTGTTTCTTTAGCTCCAGCGCGGGTGCCAAGTTTTTTGTACAAATTTGGCAGTAGAAAAAGCATTGGTCATCAATTTTTTTTCAACGAACGGGGTCCTAGCGGGCGGAATAAAAATCAAAAAAAGAAAACACGAAGGAGAAAGAATAAACCCCCCGTTTTGGCAACCTCGGGGACGAAGGACAGCGGAATGGGTN
Full Trace Sequence: GCGGAAACTGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTGTGAGTCTGGTTCCATTGCGAGTGTGATTATTATGGAAAATGTCCACAGATGTTTCATAGCACGGCCTTAAGTCAAAATCACAGTAGCCTATAGAAAACCGACCCTGAGGCTTTTTGAAGTAGTCTAAACCTCGTCCAATCTTGATCATCCAACCATTGTTGAACCTAATTTCCCGGTCATGAATAGAAGAGGAAAATGTGACCTCAAGTATTACACCATAATCATGCAATGAACTTTTGATTTCTTGAAGGCCACTGGCTTGTAGGGCTTTTCCATTATCTTCATCCATGGAGGTCAGTAAGTTGATTTTCTTTACCTTGGAAGGTCCCTTTATAAGCATTTCACAGAAACGTAAAAAGTTGTATAACTGATGCACATACCGGATGTAAGGATCTTCCACCCACACCTCTGTTAAGGTTTCATTCACATAAGGTTTGAAAAGATTTTCATAGCTGTAACCTGTTGCATTTTCTAAAATTTTTATTTGCTTGTGGTATTTTCCCTCTTCTTTCTCTTTGAGCACATGCGGGTTTGTTTCTTTAGCTCCAGCGCGGGTGCCAAGTTTTTTGTACAAATTTGGCAGTAGAAAAAGCATTGGTCATCAATTTTTTTTCAACGAACGGGGTCCTAGCGGGCGGAATAAAAATCAAAAAAAGAAAACACGAAGGAGAAAGAATAAACCCCCCGTTTTGGCAACCTCGGGGACGAAGGACAGCGGAATGGGTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTGTGAGTCTGGTTCCATT