ORFeome > mix1 ORF1 – XORFeome v1.0

mix1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mix1
Gene ID: 865559
Gene Page ID: 485897
ORF Xenbase ID: 17284185

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC068764
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11027
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TGAAATGGANTTATNTTCGGGCGTCGGGGNNANNNNNNNCCCCCAACTATATTATATTTATTATTTATTACTTNTATTATATTANNATTTATTTTTNTTTTTATATAAAAATATTTATATTAAATAAATATATTTTTATTTTATATTAATAAATAATTATTTTTTATAAATAAATAAATTTTNTTNAANAATATAATAAATTAATATATAACCATATTAATATATATAATATAATATTTTATATTAAANTATTATAATTAAANTATATTATTAAANATTATAATNTATATATNAATATANTAATNTATATTATATATATATAAATTATTATATAATATTAATATTAAATATTATATTTATTATATAATAATATAATTATTAATTATAATAANATAATNATNNAATTTATAATTAATATATATTATTATAATAATAATTAATAATATATATTATTATATAAAATATTATTATATATTTTATTANTTTAATTTATATATAAATATNTTNATATATNNTAATTAANNATAATATNAATAATATTTTTATATATTTNATATAATTAAANAATTATATTTATAATAATTTATATTTTTTATTATTTATATTATANATTNTATTANATATTAAATAAANATATATAAATAAAATAATTTTATTATTATATATTATATATTTATAANTATATTAATTAAATTAATTATAAAAATAATATAATATATTTANTAATNATTTTTNAATTTATATTTAAATTATTATTATAAATAATTTATTTATATATAAAATTAAATTATTTTTTNNANTANTTATTTATATTTATATAATATTTATAATTTATNTTTTTATTAAATTTTTTTATTAATATTATAAANTATAATTATTATTTAATAATATTTAATNATAANANTAAAATAATATTNTATATTTNTAAAATAAAAAAAATTTTTATTTAATTTTATAAANAAATATTATATNAATTATTAATTAAATATATTTAATAATAATATATAAAANAATATAATAATATAAATAATNTTTAAAATNTTTAATTTTATTTNATTTTATTTAAATATAATTATTTTTTATATATATATAATTAATTATATTAAATTTATTTAAATATAAATATAATTTAAAATAATAATATATATATNTATTATAAAAAATAATTAATATTAATTTTAAAAAAAAATAAATATTAAATTTAAAAATAANAATATNTATTTTAAAATAATAATAANAATAATNNATATTTAATTTTTTTATTTTTATTTATATANTNTAATTAAATATTATATTAAATAATTAAAAAAAAATANTAAATAAATAATATAAAATATAATATAAAAAATATATAATATATAAAAATAAATATATTTATATNATAAAATAAAAATAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGATTCAGCCAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ825487
dbEST ID: 79643189
Trimmed Sequence: AAGGTTGAGGAGCACAGAAGCAACATTTTCTTCCCAGTCTGAACTTGGCTCCGGGGAGGTGTCACTGACACCAGAATCTGAAATAGGAGAGATTTGTCCATAGGTTCCGCCCTGTGTTGTTGACATGTGACATGGCTCTTGGTTGGCAAACAAGCTCATCTGGCTTGAAGTGGTAGATACAGGTATCTGAGGGCTGGTAGAATACACCTCTGGTTTGATGTTCTTGTTGGTTTGGAAGCTGTTCATGAGCATTGGCTGAACTGGCATCTGCTGGGGGGGTCTTCTGCTGAGGTCCAACACCGTCTCCATCATATTTGTATAAACTCTGTTGGTTGTCTGTTGGTTCCACAGAGGGTTTTGAGATTTCACATTCTGATTGTAGACATTGGATGATGCCTGGGGCAGGTGGTAGGCACCAGGTGTTGGCTGGGTCATGACGAACCTCTGCCTTGAGACATTACAAGATGAATCTGGGTAGGGAAGGAATCCCTGGCTTTGGTGACACATATTCATTTGGGATTCATTCAAAGGCTGGACCTGTGCCCGGGATGTAGTCATCTGACGTGAGGAACTATAAGGGGCAAGGGGCGGAAGGAGACATTGCCCTGGTTAACCCCAGAGGTGCCGGAAGTAGGAAGGGCGCGGCAAGAAGGGGCCTGGGTGGCTTTTGCAGCGTTGAACTCCGAACCTTTGGCTCTTCTGTTCTTGAAACCAAAACCTGAAAGGGCGGAACTCCTGGGGAAAAAGAAAGGTGCCCCCAAAAAGCCCCCCCCCCCCCTTTG
Full Trace Sequence: GAAGCAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGTTGAGGAGCACAGAAGCAACATTTTCTTCCCAGTCTGAACTTGGCTCCGGGGAGGTGTCACTGACACCAGAATCTGAAATAGGAGAGATTTGTCCATAGGTTCCGCCCTGTGTTGTTGACATGTGACATGGCTCTTGGTTGGCAAACAAGCTCATCTGGCTTGAAGTGGTAGATACAGGTATCTGAGGGCTGGTAGAATACACCTCTGGTTTGATGTTCTTGTTGGTTTGGAAGCTGTTCATGAGCATTGGCTGAACTGGCATCTGCTGGGGGGGTCTTCTGCTGAGGTCCAACACCGTCTCCATCATATTTGTATAAACTCTGTTGGTTGTCTGTTGGTTCCACAGAGGGTTTTGAGATTTCACATTCTGATTGTAGACATTGGATGATGCCTGGGGCAGGTGGTAGGCACCAGGTGTTGGCTGGGTCATGACGAACCTCTGCCTTGAGACATTACAAGATGAATCTGGGTAGGGAAGGAATCCCTGGCTTTGGTGACACATATTCATTTGGGATTCATTCAAAGGCTGGACCTGTGCCCGGGATGTAGTCATCTGACGTGAGGAACTATAAGGGGCAAGGGGCGGAAGGAGACATTGCCCTGGTTAACCCCAGAGGTGCCGGAAGTAGGAAGGGCGCGGCAAGAAGGGGCCTGGGTGGCTTTTGCAGCGTTGAACTCCGAACCTTTGGCTCTTCTGTTCTTGAAACCAAAACCTGAAAGGGCGGAACTCCTGGGGAAAAAGAAAGGTGCCCCCAAAAAGCCCCCCCCCCCCCTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTTGAGGAGCACAGA