ORFeome > mks1 ORF1 – XORFeome v1.0

mks1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mks1
Gene ID: 1221188
Gene Page ID: 1221179
ORF Xenbase ID: 17284227

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127430
Original XGC clone length: 1686

Human orthology & disease relationships

NCBI Entrez ID: 54903
Ensembl gene IDs: ENSG00000011143,LRG_687
Directly associated (OMIM) disease MIM numbers: 249000,615990
Indirectly associated (Lage, et al.) disease MIM numbers: 249000

Library Location

Plate ID: GDExl11083
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ837320
dbEST ID: 79655022
Trimmed Sequence: ATGGCGGAGGATTGGAACCAGGATGTCGGGGAAGCGGTGTACAGATCGCGCGACCCCATAAATAATCTGAGGATCCGGGTGTCTCTGCAGCGGGTCACCCCGGCCATTGCGCTGGTTCAGCGGATGCAGGAGGAGGATGCAAATAGAGGAGGACTTGAGCTGCAGGCGCTGCATAGCAACCCAGAGGAGAGCAGAGGGCATCAACCTAATGAGGAGAAGGAAGAAGTGGTGATTTCCTGGCAGGAGAAACTTTTCAGCCAGTTTGAGTTTGAACTATACCAAAATGAGGCTGCCTGCAGGACACCTTTAGATCATCAGTACTACCAAGATGTATTGTCTCTTGTGAGGGGTGGGGGGCGTAAAAACAAGCGTATCTTCACCTACACAGACCACGATCGCTATACAAACCTAGAAGAGCACAGCCAATCAGTGACAACCTCTCAGAATGAAACACCCACTTTCTTGGCAGAAAGAATGGCAAATGTAAGAAGAAGACGGCAAGACAAAAGACAGGTCGATGGAGTTGGGATGCGGCATCGTTTTATTACCTTGAAACCTTCAGATGAATTCATCAGAAATAATCACATTATTAACACCCCAGTACAGACAATGTATATGATGGCAGACCTAGGACCCAGCGGAAACCTTGGCTTGAGGGAACTGAACATGTCCCTGGTACTGTTCGTGTGGATCCTAATGGGGTTATCACACGAAACCCGATGTCCCTGGCACAAGGGGCCCTTCAGGCTGGGAGGGTGGAAAGGAGGAAGGCGGGGAGCTAATGGAAAATTAACCTTTTCAACCCATTG
Full Trace Sequence: CGGGGCCCCAATAAGTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGGATTGGAACCAGGATGTCGGGGAAGCGGTGTACAGATCGCGCGACCCCATAAATAATCTGAGGATCCGGGTGTCTCTGCAGCGGGTCACCCCGGCCATTGCGCTGGTTCAGCGGATGCAGGAGGAGGATGCAAATAGAGGAGGACTTGAGCTGCAGGCGCTGCATAGCAACCCAGAGGAGAGCAGAGGGCATCAACCTAATGAGGAGAAGGAAGAAGTGGTGATTTCCTGGCAGGAGAAACTTTTCAGCCAGTTTGAGTTTGAACTATACCAAAATGAGGCTGCCTGCAGGACACCTTTAGATCATCAGTACTACCAAGATGTATTGTCTCTTGTGAGGGGTGGGGGGCGTAAAAACAAGCGTATCTTCACCTACACAGACCACGATCGCTATACAAACCTAGAAGAGCACAGCCAATCAGTGACAACCTCTCAGAATGAAACACCCACTTTCTTGGCAGAAAGAATGGCAAATGTAAGAAGAAGACGGCAAGACAAAAGACAGGTCGATGGAGTTGGGATGCGGCATCGTTTTATTACCTTGAAACCTTCAGATGAATTCATCAGAAATAATCACATTATTAACACCCCAGTACAGACAATGTATATGATGGCAGACCTAGGACCCAGCGGAAACCTTGGCTTGAGGGAACTGAACATGTCCCTGGTACTGTTCGTGTGGATCCTAATGGGGTTATCACACGAAACCCGATGTCCCTGGCACAAGGGGCCCTTCAGGCTGGGAGGGTGGAAAGGAGGAAGGCGGGGAGCTAATGGAAAATTAACCTTTTCAACCCATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGGATTGGAACCAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837319
dbEST ID: 79655021
Trimmed Sequence: GGCGGTAGATTGCTCTAGTGTTGCCTTAGATATGTTCAGAATATCCAGCGGAAGACTATCCCGGGCCTGCTGCATGCGTCGGCGTGCTCTCTGAAAGGCATCAAGGACGTTGTGAATGCTGCTCTGTTGGCTGGAATGTCCCAAATGATCCAACACACTTTGCATTCTTTTCCTCATTGATCTGCCGTCAAGGAAGGAACGTGAATGATGTAAACAGTGTAATCGCAGGGTCAGGCTCCCAGATGACTTTGTTCTGAAGCCTAAACGACTAAGATGTTGCCCCTGAAATGTTCCAGGCACTCGGACATAAGTCAGATCCTCAAGCTCTGGAGAACCACCAATGAAAAATCTTTTGAGCTCAGTGAGCACACCCAATTCAACAGGTCGCCATGTCTGAGCTGTGAGGACATGCATTCCTGGAGTCCCTGGTAAGACAACAGACCCATATCCTTCAACTCTATACCTTTGCCAAAAATCTAGTGATAGGACTTCAAAGAAAAGCACCGGCAACTGCGGGGTCTCTTCAGAATCAGCCTCCTCTGACAGAAAGAGCTCANAACTGAAGGGATAACAGAAGTAAGCAACACTGTCCCTTTCGTGAGTTTTTGTCCGGCAGCTTTGGGTGACTCCCGAGAGCTCCTGGAATCCTGGGCTGGACCAGTAATTAGGGAGCTCCACAAAGAAATGAACATAAAAGATAATCTAAATCAAACTCCTGGGGCCAAGACAATTTCCCCATTAATGGAAGACTCCTAAAGGTTACC
Full Trace Sequence: GGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCGGTAGATTGCTCTAGTGTTGCCTTAGATATGTTCAGAATATCCAGCGGAAGACTATCCCGGGCCTGCTGCATGCGTCGGCGTGCTCTCTGAAAGGCATCAAGGACGTTGTGAATGCTGCTCTGTTGGCTGGAATGTCCCAAATGATCCAACACACTTTGCATTCTTTTCCTCATTGATCTGCCGTCAAGGAAGGAACGTGAATGATGTAAACAGTGTAATCGCAGGGTCAGGCTCCCAGATGACTTTGTTCTGAAGCCTAAACGACTAAGATGTTGCCCCTGAAATGTTCCAGGCACTCGGACATAAGTCAGATCCTCAAGCTCTGGAGAACCACCAATGAAAAATCTTTTGAGCTCAGTGAGCACACCCAATTCAACAGGTCGCCATGTCTGAGCTGTGAGGACATGCATTCCTGGAGTCCCTGGTAAGACAACAGACCCATATCCTTCAACTCTATACCTTTGCCAAAAATCTAGTGATAGGACTTCAAAGAAAAGCACCGGCAACTGCGGGGTCTCTTCAGAATCAGCCTCCTCTGACAGAAAGAGCTCANAACTGAAGGGATAACAGAAGTAAGCAACACTGTCCCTTTCGTGAGTTTTTGTCCGGCAGCTTTGGGTGACTCCCGAGAGCTCCTGGAATCCTGGGCTGGACCAGTAATTAGGGAGCTCCACAAAGAAATGAACATAAAAGATAATCTAAATCAAACTCCTGGGGCCAAGACAATTTCCCCATTAATGGAAGACTCCTAAAGGTTACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCGGTAGATTGCTCTAGT