ORFeome > mlh1 ORF1 – XORFeome v1.0

mlh1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mlh1
Gene ID: 5838719
Gene Page ID: 5838710
ORF Xenbase ID: 17284269

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124966
Original XGC clone length: 2253

Human orthology & disease relationships

NCBI Entrez ID: 4292
Ensembl gene IDs: ENSG00000076242,LRG_216
Directly associated (OMIM) disease MIM numbers: 158320,276300,609310
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,120435,151623,155601,158320,210900,242860,276300,606719,608089,609310

Library Location

Plate ID: GDExl11083
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ837324
dbEST ID: 79655026
Trimmed Sequence: ATGGCGGGAGTTATTCGGCGGCTGGAGGAGACCGTGGTTAACCGGATAGCTGCTGGAGAGGTCATCCAGAGGCCGGCCAATGCAATCAAGGAAATGATTGAAAACTGTTTAGATGCCAAGTCTACCTCCATCCAGGTGACCGTGAAAGATGGAGGGATGAAACTGATCCAGATTCAGGACAATGGAACTGGCATCAGGAAGGAAGACTTAGACATAGTATGTGAGAGATTTACTACAAGCAAGCTGCAATCATTTGAGGATTTGTCCAATATTTCCACTTATGGGTTTCGAGGAGAAGCATTGGCCAGCGTAAGTCATGTGGCTCATGTTACAATAACTACCAAAACAGCAGATGGAAAATGTGCCTACAGAGCAAGCTATGCAGATGGCAAGTTAAAAGCACCTCCAAAACCTTGTGCTGGAAACCAAGGAACCCAGATTTCGGTCGAAGATCTTTTTTATAATGTTTCAACAAGGCGAAAAGCTCTAAAGAGTCCAAGTGAAGAGCATGCAAGAATAGTTGAAGTTGTCAGCAGGTACGCTATCCATAACTCTGGAATCGGTTTTTCGGTCAAAAAGCAAGGTGAAACTATGGCAGATGTAAGAACATTATCTAATGCAACTACGGTGGACAATATCAGAACTGTTTTTGGAATGCAGTGAGCAGGGAACTTATAGGAAGTTGGCTGTGTAGAGGATAAACTTGCATTTTAAATTGAAGGGTTATGTGACCAATGCCAACTATTTCTTGAAAAAAATGGTATTTTCATTACTCTTTCTTTATTTGCAAAAACTTTTCCGAATACCCCCGGCATTTAAAAAAAAAACAAA
Full Trace Sequence: CGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGTTATTCGGCGGCTGGAGGAGACCGTGGTTAACCGGATAGCTGCTGGAGAGGTCATCCAGAGGCCGGCCAATGCAATCAAGGAAATGATTGAAAACTGTTTAGATGCCAAGTCTACCTCCATCCAGGTGACCGTGAAAGATGGAGGGATGAAACTGATCCAGATTCAGGACAATGGAACTGGCATCAGGAAGGAAGACTTAGACATAGTATGTGAGAGATTTACTACAAGCAAGCTGCAATCATTTGAGGATTTGTCCAATATTTCCACTTATGGGTTTCGAGGAGAAGCATTGGCCAGCGTAAGTCATGTGGCTCATGTTACAATAACTACCAAAACAGCAGATGGAAAATGTGCCTACAGAGCAAGCTATGCAGATGGCAAGTTAAAAGCACCTCCAAAACCTTGTGCTGGAAACCAAGGAACCCAGATTTCGGTCGAAGATCTTTTTTATAATGTTTCAACAAGGCGAAAAGCTCTAAAGAGTCCAAGTGAAGAGCATGCAAGAATAGTTGAAGTTGTCAGCAGGTACGCTATCCATAACTCTGGAATCGGTTTTTCGGTCAAAAAGCAAGGTGAAACTATGGCAGATGTAAGAACATTATCTAATGCAACTACGGTGGACAATATCAGAACTGTTTTTGGAATGCAGTGAGCAGGGAACTTATAGGAAGTTGGCTGTGTAGAGGATAAACTTGCATTTTAAATTGAAGGGTTATGTGACCAATGCCAACTATTTCTTGAAAAAAATGGTATTTTCATTACTCTTTCTTTATTTGCAAAAACTTTTCCGAATACCCCCGGCATTTAAAAAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGTTATTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837323
dbEST ID: 79655025
Trimmed Sequence: GCACCTTTCAAACACTTTATATAAGTCGGGGAGATTTGCAATTTGAAGGATGCTTCCATCTTCTGTAAAGGGCTTTGGAGGTAGTAGGTGAGTCCTGAAGGCTTTGTATAGAATGTGTTCTGTAGTCCAGCGCCAAGAGGAGGACCCTGTTAAAGATTTGTTGTCCGCATTATTGGAAGATTCGTCTAATATATACTGCTTCCGAATGGAGTAAAAATTGGAACATTCCTTGCTAAAGCTTGCAAAGCACTCCTTCTCATCATCCCAATTGACCTCTGTGGCTAGGCGCAAAATAAACAACGGCAATCCTTCCATAGGAGGGATGTAGTTGTCCAGCAGTAAAGGTAATCCTATAAGGTTTCCTTCCTGATCAATTTCAAGTGAGTAGTAGTCTGCCAACATCTCTGTCTTCTTCTTTAAAAACTGTACAATATACTCAGCAAGACCTTCTTTGGGACCATCTTCTTCTGTCCACCCACTCTCTTTATTATCCAAGGCTAGCATTGCCAAGTCATAAAGTGGAGCTGGCTCGGATAATTTCATTACGCCAAAGTTTCCAAAGTCATAAATGAGTATCTGATAAAATAATTCCTGGCTGAGTTTAGTGGTGTTTAGGAGATATAACTTTTGTCTGAAACTGAGCTAAAACCCACTGAGGAATGACGCAGCCAACAAACGAATGATTTAATTAGCATGGTCCGGAAGACCTGTAATGACCACACCTCTTCAATCTCCTTTTCTGCAAGCTCAAAAATTACCTGGTAAAAATTTAAAA
Full Trace Sequence: GGGAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCACCTTTCAAACACTTTATATAAGTCGGGGAGATTTGCAATTTGAAGGATGCTTCCATCTTCTGTAAAGGGCTTTGGAGGTAGTAGGTGAGTCCTGAAGGCTTTGTATAGAATGTGTTCTGTAGTCCAGCGCCAAGAGGAGGACCCTGTTAAAGATTTGTTGTCCGCATTATTGGAAGATTCGTCTAATATATACTGCTTCCGAATGGAGTAAAAATTGGAACATTCCTTGCTAAAGCTTGCAAAGCACTCCTTCTCATCATCCCAATTGACCTCTGTGGCTAGGCGCAAAATAAACAACGGCAATCCTTCCATAGGAGGGATGTAGTTGTCCAGCAGTAAAGGTAATCCTATAAGGTTTCCTTCCTGATCAATTTCAAGTGAGTAGTAGTCTGCCAACATCTCTGTCTTCTTCTTTAAAAACTGTACAATATACTCAGCAAGACCTTCTTTGGGACCATCTTCTTCTGTCCACCCACTCTCTTTATTATCCAAGGCTAGCATTGCCAAGTCATAAAGTGGAGCTGGCTCGGATAATTTCATTACGCCAAAGTTTCCAAAGTCATAAATGAGTATCTGATAAAATAATTCCTGGCTGAGTTTAGTGGTGTTTAGGAGATATAACTTTTGTCTGAAACTGAGCTAAAACCCACTGAGGAATGACGCAGCCAACAAACGAATGATTTAATTAGCATGGTCCGGAAGACCTGTAATGACCACACCTCTTCAATCTCCTTTTCTGCAAGCTCAAAAATTACCTGGTAAAAATTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACCTTTCAAACACTTTA