ORFeome > mmadhc ORF1 – XORFeome v1.0

mmadhc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mmadhc
Gene ID: 973167
Gene Page ID: 973160
ORF Xenbase ID: 17284311

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097712
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID: 27249
Ensembl gene IDs: ENSG00000168288
Directly associated (OMIM) disease MIM numbers: 277410
Indirectly associated (Lage, et al.) disease MIM numbers: 102700,229100,242100,250940,266120,278300,300322,300323,600462,603896,605258,605899,606054,609015

Library Location

Plate ID: GDExl11089
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ838391
dbEST ID: 79656093
Trimmed Sequence: ATGGCTAATGCCCTCTGTAGCAGAGCCAGACTGGTGACCTACGTCCCTGGGTTTTGTTCTTTGATAAGAAGGGTCTCAGGTACCCGGGCTTTTTCCACAGCAGGATCTTCAGGCTCTGATGAGCCTTACATTGCTGCTACACCTCCTGATATACTTCCTAGGACAGTATGGCCCGATGAGACTATGGGCCCCTTTGGCCCACAAGACCACCGTTTTCAGCTTCCAGGTAATGTAGGATTTGATGTCCACGTGAATGGAGTAGACAATAAGAGGAAAATAGAAGTCAATAAAAATCTACCGGACTTGCTAACTGAACCTCAACCAAGCGAAAGACATGAATTTGTAATGGCCCAATTTGTTACTGAATTCCAGGGGAGTGAAGTTTCACTGCAGCCACAAGAATTGAACACTATAGAAAGCTACTTTGAAAATGCAAAGGTGGAATGCGCAATGCAGTCTTGCCCAGATCTGCTGAAAAAAGATTTTGCTTCTATGTTTCCTGAAATTCCCGGGAATAATTTTATGGTGCTAACAGTTACTCACAGGACGAAGAATGATATGACCGCTTGGAGTCAAGAGGTCGAAAACGAGAAGGAAATGTTAATGGAAAAGTTCATAAATGGTGCCCGGGAGATTTGCTATGCGCTAAGGACAGAAGGAT
Full Trace Sequence: GGGGGCACCATATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAATGCCCTCTGTAGCAGAGCCAGACTGGTGACCTACGTCCCTGGGTTTTGTTCTTTGATAAGAAGGGTCTCAGGTACCCGGGCTTTTTCCACAGCAGGATCTTCAGGCTCTGATGAGCCTTACATTGCTGCTACACCTCCTGATATACTTCCTAGGACAGTATGGCCCGATGAGACTATGGGCCCCTTTGGCCCACAAGACCACCGTTTTCAGCTTCCAGGTAATGTAGGATTTGATGTCCACGTGAATGGAGTAGACAATAAGAGGAAAATAGAAGTCAATAAAAATCTACCGGACTTGCTAACTGAACCTCAACCAAGCGAAAGACATGAATTTGTAATGGCCCAATTTGTTACTGAATTCCAGGGGAGTGAAGTTTCACTGCAGCCACAAGAATTGAACACTATAGAAAGCTACTTTGAAAATGCAAAGGTGGAATGCGCAATGCAGTCTTGCCCAGATCTGCTGAAAAAAGATTTTGCTTCTATGTTTCCTGAAATTCCCGGGAATAATTTTATGGTGCTAACAGTTACTCACAGGACGAAGAATGATATGACCGCTTGGAGTCAAGAGGTCGAAAACGAGAAGGAAATGTTAATGGAAAAGTTCATAAATGGTGCCCGGGAGATTTGCTATGCGCTAAGGACAGAAGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAATGCCCTCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838390
dbEST ID: 79656092
Trimmed Sequence: GTGTTCCCCTAGTTTCTTCATGATAGCACTGTCTGAGGGAGCGTTGGTAAATATACTTCCCACAACCGCATGTGTTCCCCAGACACTGTGGCGAATTACTTTACAGCAACCCAGATCCTCCACTTTGAATCCCAGGTGGCGATAGCGCTCATCTGTTTCAAATAGGGTGTTGTTTGTGTAAGGCCCAAAATATGCAAGCCCAGACAGTGGGTCAATAAAGTCCGCCCAGTATCCTTCTGTCCTTAGCGCATAGCAAATCTCCTTGGCACCATTTATGAACTTTTCCATTAACATTTCCCTCTCGTTTTCGACCTCTTGACTCCCAGCGGTCATATCATTTTTCGTCCTCTGAGTAGCTGTTAGCACCATAGAATTATTCCCGGGAATTTCAGGAAACATATAAACAAAATCTTTTTTCAGCAAATCTGGGCAAGACTGCATTGCGCAGTCCACCTTTGCCTTTTCAAAGTAGCTTTCTATAGTGGTCAGTTCTTGTGGGGGGCGGTGAAACTTCACTCCCCTGGAATTGAGTTAAAAATTTGGGCGGTGGCAAAATTCATGTCTTTCGGCTTGTTTAAAGGTTTGGTTAGCAAGTCCCGGTAGAGTTTTATTTGAGTTGGGTTTTCCGGCTGTTTGTGGGGGGGCGGTTGGGGGAGGGG
Full Trace Sequence: GGGGGAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTTCCCCTAGTTTCTTCATGATAGCACTGTCTGAGGGAGCGTTGGTAAATATACTTCCCACAACCGCATGTGTTCCCCAGACACTGTGGCGAATTACTTTACAGCAACCCAGATCCTCCACTTTGAATCCCAGGTGGCGATAGCGCTCATCTGTTTCAAATAGGGTGTTGTTTGTGTAAGGCCCAAAATATGCAAGCCCAGACAGTGGGTCAATAAAGTCCGCCCAGTATCCTTCTGTCCTTAGCGCATAGCAAATCTCCTTGGCACCATTTATGAACTTTTCCATTAACATTTCCCTCTCGTTTTCGACCTCTTGACTCCCAGCGGTCATATCATTTTTCGTCCTCTGAGTAGCTGTTAGCACCATAGAATTATTCCCGGGAATTTCAGGAAACATATAAACAAAATCTTTTTTCAGCAAATCTGGGCAAGACTGCATTGCGCAGTCCACCTTTGCCTTTTCAAAGTAGCTTTCTATAGTGGTCAGTTCTTGTGGGGGGCGGTGAAACTTCACTCCCCTGGAATTGAGTTAAAAATTTGGGCGGTGGCAAAATTCATGTCTTTCGGCTTGTTTAAAGGTTTGGTTAGCAAGTCCCGGTAGAGTTTTATTTGAGTTGGGTTTTCCGGCTGTTTGTGGGGGGGCGGTTGGGGGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTTCCCCTAGTTTCTTC