ORFeome > mmp-9th ORF1 – XORFeome v1.0

mmp-9th ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 981903
Gene Page ID: 981899
ORF Xenbase ID: 17284329

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128676
Original XGC clone length: 2025

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGGGGCCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTGGGCTGTGTGTTTTTGTCCAATTTTCAATACTTTGTGCGTGGGGTCACTCTGCTCCCACAGCCACCAAAACCCCTGTGTCAATTACATTTCCAGGGAAAATCCGAAACAACATGACAAGTGTGAAGGTGGCGAATTGGAATCTGGTGAATTTTGGGTATCTGCCCCTCCACCAGGGCTCAAACCATCATGTCCCCTTAAAAAAACCTCTCACCCAAATGCAAATTAACCTGGAACAAAAGGTTACTGAAAACCTGAATCCTAAAACATTGAATGCCAGAAAAACCCCCCAATTTGCAAAACAAAATATTGTCAATTACAACACGTTTAAGGGGGAATTAAATTGGAATAACAATGATCTCTCATATCTAATCCAAAACAACCCCCCTAACACGAACCCCAATGTAATCAATAAAACCTTCCCCCCGCCAATCAAATACGGAAGTAATAACACACCTCTAACCTTAACGCAAAAAGACAAGGGTGGAAACGCAATATCGAAATAAAATAAAAGAAGAAAAAAACGTAATGAATCCATACCCCACCGAACGTAAAAGATGGCCCGCGAGCCCCATGGGGAAACCCCCGAGCCCTGGAAATGAGAGGCAAACACAAATATATAACAAAAAAAAAAGAAGGAAACCCTAAGAAAAAGAGAAGAGGGGAAAGAAGCGAAGATATCACAATAGGCCAAAGGACCCCCCGGAGGGGGCTTCCCTTTTTTATTATTAATGGGCCCAGACCTCGAAGACGACCCGCATGAAAATTTTAAGTGAAGCCACATCAGACAAGCGACGTGCACTAAGAGTAGATCAGTGCCAACGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTGGGCTGTGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838851
dbEST ID: 79656553
Trimmed Sequence: TTTTTGCTCTGGGCAGTGCAACAGATCATATTTGACATAACCAACTCTGTCAACTTGCTTGCGTGATGTCATGCGCCACAAGAAGCGATCCTGACAGAAATAATATTTCCCTTGGTACAGGAAAACATCATGGGAGTCACTTGGAACACCAGCATAATCTACATCTGTCAATCGTGGGTATCCTTTGTCGAGGGTCAATGTCTTTACATTAAGCCTCCACTATCGCTCCCCGTTGAATAACAGGGCCATTCCATTATCACGAGCAAAAGATCCCATGATGCCCTCCACATCCTTGCTCAGACCCAACTTCTCAATGCTGCGTGGACCTAAGACACTCTTCCCTGTATACTGCCAGAACTTGCGCCCTGAGAAGAAATACATGTTCTTGCTGGTGGGGTCCTGGAATGCAGTGTCAATTTTAGAGGGAAGGGCTGGCCATGTGTCCGAGATTTTGCGAGGAGACTGTGGCGCATTCTTATTTTTGGAGGTCACAGTCCAGAACAACACGTCTTTGACAAATTGCACAGCTCCTTGTAGCTCTGCAATGGCGTCAAACATTTTCACTTTCAAGCATCGAGAGCAGGGTTCACAGATGGTGTCAATGCGGTGGGTAATACTGTCCTGCGGCCACTGGGGCGGGGGTTGTAATTGCCCAATTTCTGGTATTGGACAATCGAGGGGTTTTTCCTGGCCTTCCAATGTTTCAAACATCCCAGGTTTCCCAGGTTACCCCTTAAATCCCCAGCCCTTACCTTTGTCATTTTTGCC
Full Trace Sequence: AAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTGCTCTGGGCAGTGCAACAGATCATATTTGACATAACCAACTCTGTCAACTTGCTTGCGTGATGTCATGCGCCACAAGAAGCGATCCTGACAGAAATAATATTTCCCTTGGTACAGGAAAACATCATGGGAGTCACTTGGAACACCAGCATAATCTACATCTGTCAATCGTGGGTATCCTTTGTCGAGGGTCAATGTCTTTACATTAAGCCTCCACTATCGCTCCCCGTTGAATAACAGGGCCATTCCATTATCACGAGCAAAAGATCCCATGATGCCCTCCACATCCTTGCTCAGACCCAACTTCTCAATGCTGCGTGGACCTAAGACACTCTTCCCTGTATACTGCCAGAACTTGCGCCCTGAGAAGAAATACATGTTCTTGCTGGTGGGGTCCTGGAATGCAGTGTCAATTTTAGAGGGAAGGGCTGGCCATGTGTCCGAGATTTTGCGAGGAGACTGTGGCGCATTCTTATTTTTGGAGGTCACAGTCCAGAACAACACGTCTTTGACAAATTGCACAGCTCCTTGTAGCTCTGCAATGGCGTCAAACATTTTCACTTTCAAGCATCGAGAGCAGGGTTCACAGATGGTGTCAATGCGGTGGGTAATACTGTCCTGCGGCCACTGGGGCGGGGGTTGTAATTGCCCAATTTCTGGTATTGGACAATCGAGGGGTTTTTCCTGGCCTTCCAATGTTTCAAACATCCCAGGTTTCCCAGGTTACCCCTTAAATCCCCAGCCCTTACCTTTGTCATTTTTGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTGCTCTGGGCAGTG