ORFeome > mmp1 ORF1 – XORFeome v1.0

mmp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mmp1
Gene ID: 856365
Gene Page ID: 485008
ORF Xenbase ID: 17284335

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129519
Original XGC clone length: 1404

Human orthology & disease relationships

NCBI Entrez ID: 4312
Ensembl gene IDs: ENSG00000196611
Directly associated (OMIM) disease MIM numbers: 226600,606963
Indirectly associated (Lage, et al.) disease MIM numbers: 130060,166200,166210,166220,231200,259420

Library Location

Plate ID: GDExl11092
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838932
dbEST ID: 79656634
Trimmed Sequence: ATGAACAGCCTCCTGCTAAAGCTGCTACTATGTGTAGCCCTTACCGCTGCCTTCCCCGCAGATAAACAAGATGAGCCCCCAGCAACAAAGGAAGAAATGGCAGAGAATTACTTGAAGAGATTTTACAGTCTTGGAACTGATGGGGGACCAGTTGGAAGAAAGAAACACATCCAACCTTTCACTGAAAAGCTCCAGCAGATGCAGAAGTTTTTTGGCTTAAAGGTGACAGGAACATTGGACCCCAAGACTGTAGAAGTAATGGAGAAACCCAGATGTGGAGTCTATGATGTTGGCCAGTACAGCACAGTCGCAAAAAGTTCTGCATGGCAGAAGAAGGATCTGACCTACAGAATTCTAAACTTCACTCCTGACCTGCCTCAGGCTGATGTGGAGACTGCCATACAAAGAGCTTTCAAAGTCTGGAGTGACGTGACACCTTTGACCTTTACCACAATCTACAATGAAGTATCAGATATAGAAATCTCCTTTACAGCTGGAGATCACAAAGACAATTCTCCTTTTGATGGAGCTGGTGGCATTTTGACCCATGCCTTTCATCCCAACAATGGCATTGGTGGAGATGGGGATTTGGATTAAGATGAAACCTAAACGAGGAGCAATAAAAATACAATCAGGTTCTTGTTGCTGCTCGTGGGTTTGGAACTTTCCTACACCTTGCTCGTCCCCCTAACCAGGTGCGTTGGGGGGATGGGAGGAGGCCAGTAACGAACCCTGGGAATTTCAGTTTTCCTTCTCTTCCCCCCCATGCCAATGCAGAAAGGTAACTCTAAAGGTTTTTTGTGTTTGTTTTCTACT
Full Trace Sequence: CGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACAGCCTCCTGCTAAAGCTGCTACTATGTGTAGCCCTTACCGCTGCCTTCCCCGCAGATAAACAAGATGAGCCCCCAGCAACAAAGGAAGAAATGGCAGAGAATTACTTGAAGAGATTTTACAGTCTTGGAACTGATGGGGGACCAGTTGGAAGAAAGAAACACATCCAACCTTTCACTGAAAAGCTCCAGCAGATGCAGAAGTTTTTTGGCTTAAAGGTGACAGGAACATTGGACCCCAAGACTGTAGAAGTAATGGAGAAACCCAGATGTGGAGTCTATGATGTTGGCCAGTACAGCACAGTCGCAAAAAGTTCTGCATGGCAGAAGAAGGATCTGACCTACAGAATTCTAAACTTCACTCCTGACCTGCCTCAGGCTGATGTGGAGACTGCCATACAAAGAGCTTTCAAAGTCTGGAGTGACGTGACACCTTTGACCTTTACCACAATCTACAATGAAGTATCAGATATAGAAATCTCCTTTACAGCTGGAGATCACAAAGACAATTCTCCTTTTGATGGAGCTGGTGGCATTTTGACCCATGCCTTTCATCCCAACAATGGCATTGGTGGAGATGGGGATTTGGATTAAGATGAAACCTAAACGAGGAGCAATAAAAATACAATCAGGTTCTTGTTGCTGCTCGTGGGTTTGGAACTTTCCTACACCTTGCTCGTCCCCCTAACCAGGTGCGTTGGGGGGATGGGAGGAGGCCAGTAACGAACCCTGGGAATTTCAGTTTTCCTTCTCTTCCCCCCCATGCCAATGCAGAAAGGTAACTCTAAAGGTTTTTTGTGTTTGTTTTCTACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAGCCTCCTGCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838931
dbEST ID: 79656633
Trimmed Sequence: ACAGCCCAACCAGCTGTTGCTTCTTAAGACCTGTACGATTCTTTTAGAGTTGATATTGTATTCAAACTGGCTCCTTCCAATGAAGAAATACAGGCGGTCTCTGTAATAAAAAGCTGCATCAATTTTATCAGGAATTCCCGGGAAATCGTTGCTTATTTGCTTTGGAAAGCCTTTGTCCATTTGTTTTTTATCTTCATCATAACTCCAGTATTTCTTAGCTGCAAAGAAATATGTTTTCCCTAGTTGTTCAATATGAACAGCCGCATCAATTCTTTTCACGGTCTTTGGAAATCCCAGGCTGTAGATGTTCCTGGGGTAACCTTGTACTACATCGAAGCCGTCCAGAGCTGTATATTTTGATCCTTTAAACACAAGGATCTGCTCCGTTATAGGATTTTCATACGCCGCATCAATATTAGTGGGCAGCGATGGCCAGAATGCTTGAACAAACATGAGTTCAGCCTCGGATGCTTGGGGATGCTTCCTCCATAAAAACCTCTTCACAAAGAAAATCAGTTCTCCTCTCATGGTGGTGACAGCATTGAAAACAACATTTGGATCACATCTGGAAGGAGTGGATGGTCCGGGTTGGTGGACTGGATTGGAGGATTTTCATATAGATACTGTATAGCATTGATATCATCCTTGAGAAGCTGAAATGTCTTTGGGGTCGGGAATTTGAGTATGTTGGGATACCTCAAAACCACCCTGGAACAGTGGGAATGGAGAAAAGCCCCCACCGAATTGTTCAAAATTTCCTGGAACCGCCAAAAA
Full Trace Sequence: AAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGCCCAACCAGCTGTTGCTTCTTAAGACCTGTACGATTCTTTTAGAGTTGATATTGTATTCAAACTGGCTCCTTCCAATGAAGAAATACAGGCGGTCTCTGTAATAAAAAGCTGCATCAATTTTATCAGGAATTCCCGGGAAATCGTTGCTTATTTGCTTTGGAAAGCCTTTGTCCATTTGTTTTTTATCTTCATCATAACTCCAGTATTTCTTAGCTGCAAAGAAATATGTTTTCCCTAGTTGTTCAATATGAACAGCCGCATCAATTCTTTTCACGGTCTTTGGAAATCCCAGGCTGTAGATGTTCCTGGGGTAACCTTGTACTACATCGAAGCCGTCCAGAGCTGTATATTTTGATCCTTTAAACACAAGGATCTGCTCCGTTATAGGATTTTCATACGCCGCATCAATATTAGTGGGCAGCGATGGCCAGAATGCTTGAACAAACATGAGTTCAGCCTCGGATGCTTGGGGATGCTTCCTCCATAAAAACCTCTTCACAAAGAAAATCAGTTCTCCTCTCATGGTGGTGACAGCATTGAAAACAACATTTGGATCACATCTGGAAGGAGTGGATGGTCCGGGTTGGTGGACTGGATTGGAGGATTTTCATATAGATACTGTATAGCATTGATATCATCCTTGAGAAGCTGAAATGTCTTTGGGGTCGGGAATTTGAGTATGTTGGGATACCTCAAAACCACCCTGGAACAGTGGGAATGGAGAAAAGCCCCCACCGAATTGTTCAAAATTTCCTGGAACCGCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGCCCAACCAGCTGTTGCTT