ORFeome > mmp11 ORF1 – XORFeome v1.0

mmp11 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mmp11
Gene ID: 865255
Gene Page ID: 479264
ORF Xenbase ID: 17284347

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC054949
Original XGC clone length: 1434

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ839100
dbEST ID: 79656802
Trimmed Sequence: ATGCATCTCCTCATCCTTCTACCTGCACTGTGTGTACTTGGAGCTCACTCAGCCCCTCTGTCATACACTTACCTTCAGCACAGAATCCAGGAAAAGCCTCAGAAAGATCATGGCAGGTTGCAGTTTAATTCATTACATTATCCTCATATAAAGGGACTGCTCAATGCTCACGGTTCATGGAACCCCCCACGCTGTGGAGTACCAGATATTCCTGCCCCTCTAGATTCCTCCAGTGGTCGAAATCGTCAGAAACGGTTTGTCCTGTCGGGAGGACGCTGGGACAAGACAAACCTGACGTACAAGATCATCCGTTTCCCATGGCAGCTAAGTAAGGTGAAAGTGAGACGCACTATTGCAGAAGCCCTAAAGGTATGGAGCGAGGTTACCCCTTTGACTTTCACTGAGGTGCATGAAGGACGCTCTGATATCATAATTGACTTCACACGGTACTGGCATGGAGATAATCTCCCATTTGATGGTCCGGGGGGTATCTTGGCACATGCTTTCTTCCCAAAAACCCATCGAGAGGGGGATGTACATTTTGATTATGATGAAGCTTGGACTATTGGAAACAATATAGGTACAGACCTACTTCAAGTAGCTGCCCATGAGTTTGGTCATATGCTCGGCCTGCAGCATTCTTCCATTTCCAAATCGCTTATGTCACCATTTTTACCATTCCGTTTACCACTAAGCCCTTATTGCAGAAGAACAGCATGGCAAAACAATTTTTGTATGGGGGCCCCGCCGTCCTCCCAACTCCCTCCCCAACCCCCCAAGGGGTGAAAGGTTCAACCCGGGGGGGAA
Full Trace Sequence: CGGGGGCCCACATAATAGATTTTATGTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATCTCCTCATCCTTCTACCTGCACTGTGTGTACTTGGAGCTCACTCAGCCCCTCTGTCATACACTTACCTTCAGCACAGAATCCAGGAAAAGCCTCAGAAAGATCATGGCAGGTTGCAGTTTAATTCATTACATTATCCTCATATAAAGGGACTGCTCAATGCTCACGGTTCATGGAACCCCCCACGCTGTGGAGTACCAGATATTCCTGCCCCTCTAGATTCCTCCAGTGGTCGAAATCGTCAGAAACGGTTTGTCCTGTCGGGAGGACGCTGGGACAAGACAAACCTGACGTACAAGATCATCCGTTTCCCATGGCAGCTAAGTAAGGTGAAAGTGAGACGCACTATTGCAGAAGCCCTAAAGGTATGGAGCGAGGTTACCCCTTTGACTTTCACTGAGGTGCATGAAGGACGCTCTGATATCATAATTGACTTCACACGGTACTGGCATGGAGATAATCTCCCATTTGATGGTCCGGGGGGTATCTTGGCACATGCTTTCTTCCCAAAAACCCATCGAGAGGGGGATGTACATTTTGATTATGATGAAGCTTGGACTATTGGAAACAATATAGGTACAGACCTACTTCAAGTAGCTGCCCATGAGTTTGGTCATATGCTCGGCCTGCAGCATTCTTCCATTTCCAAATCGCTTATGTCACCATTTTTACCATTCCGTTTACCACTAAGCCCTTATTGCAGAAGAACAGCATGGCAAAACAATTTTTGTATGGGGGCCCCGCCGTCCTCCCAACTCCCTCCCCAACCCCCCAAGGGGTGAAAGGTTCAACCCGGGGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCTCCTCATCCTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839099
dbEST ID: 79656801
Trimmed Sequence: TCTTAATGAATTAACAAATGTAGAGCTTGCTTGACAGTTGAAGAAATCTTGACTGATCAGGTGAGGATACCTATCCATGACACGAACTTTGAACGGGTCAAATTTCCAGTACTGTCGTCCTTTTACAAAATAGGCATAACCTTGTTCATCCTGGAAAGCAGCATCAATGCCTTTAGGTACCCCTCTCCAGTCTCCAATCCTCCGTGAGTGCCGGCTTTCCACTCGTCTAGTTTCTGGGTTGAATCGCCAGTATTCTCCACCCCTAAACAGATAGGTTTTCTTGTTCTTTTCTGTACCCCACACGAAGGCGGCCTGAATCTGTGTCACTGATATGCCAATGTCAGTAATTGGAAAGGGCCCCGACGCCTGCAGCTTCCCATCAAAGACCCAAAACTGTGAGCCATAGAAGAACCAGATGTTTCCCACAGAATCTTCAAATGCTGCATCGACTGTATCAGGGATCCCTCGCCAGTGGCGTGATGCCAGGGCTGGGTAGCCATTCTGCAATTTCCCACCACGAAGGCGCCATACATAACCAGACTTGAAGAAGAATAACTCTCCCCGAATTGTAAACACCGCATCAAAATTAGTTTTGCATGCATCAGGGTCTGCCGCAGGAATCCTCATACTCTCATTTTCCACCTGGTTGACCTCCCCCCTAAGGGGTTGGGGAAGGGAGTCGGAAGGAACCGGAACCCCAATACAAAAATTTGTATGCCCCATGCTTGGTCCACCGGCCCCTAAAGGGCCTTAAGGGGGGTTAAC
Full Trace Sequence: GCGAGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTAATGAATTAACAAATGTAGAGCTTGCTTGACAGTTGAAGAAATCTTGACTGATCAGGTGAGGATACCTATCCATGACACGAACTTTGAACGGGTCAAATTTCCAGTACTGTCGTCCTTTTACAAAATAGGCATAACCTTGTTCATCCTGGAAAGCAGCATCAATGCCTTTAGGTACCCCTCTCCAGTCTCCAATCCTCCGTGAGTGCCGGCTTTCCACTCGTCTAGTTTCTGGGTTGAATCGCCAGTATTCTCCACCCCTAAACAGATAGGTTTTCTTGTTCTTTTCTGTACCCCACACGAAGGCGGCCTGAATCTGTGTCACTGATATGCCAATGTCAGTAATTGGAAAGGGCCCCGACGCCTGCAGCTTCCCATCAAAGACCCAAAACTGTGAGCCATAGAAGAACCAGATGTTTCCCACAGAATCTTCAAATGCTGCATCGACTGTATCAGGGATCCCTCGCCAGTGGCGTGATGCCAGGGCTGGGTAGCCATTCTGCAATTTCCCACCACGAAGGCGCCATACATAACCAGACTTGAAGAAGAATAACTCTCCCCGAATTGTAAACACCGCATCAAAATTAGTTTTGCATGCATCAGGGTCTGCCGCAGGAATCCTCATACTCTCATTTTCCACCTGGTTGACCTCCCCCCTAAGGGGTTGGGGAAGGGAGTCGGAAGGAACCGGAACCCCAATACAAAAATTTGTATGCCCCATGCTTGGTCCACCGGCCCCTAAAGGGCCTTAAGGGGGGTTAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTAATGAATTAACAAATGTAGA