ORFeome > mmp14 ORF1 – XORFeome v1.0

mmp14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mmp14
Gene ID: 485647
Gene Page ID: 485642
ORF Xenbase ID: 17284359

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133189
Original XGC clone length: 1728

Human orthology & disease relationships

NCBI Entrez ID: 4323
Ensembl gene IDs: ENSG00000157227
Directly associated (OMIM) disease MIM numbers: 277950
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ838595
dbEST ID: 79656297
Trimmed Sequence: ATGGAGCCTCTGAGAGCAGCCTGGATTTGCCTGTTTCTGTGTTCTGTGTGCAGCTCCAACCCTTCCAAATTCAGCCCAGAGGCCTGGCTTCAACAGTATGGATATCTGCCCCCTGGAGATCTGCGGACACACACCTTACGCTCCCCTCAGTCCATGAGTGCTGCAGTCTCTGCCATGCAGAAGTTCTATGGCTTAAAAGTGACAGGAAAGTTTGACAGTGACACAGAGAAAGCAATGAAGAAGCCACGATGTGGAGTCCCTGACAAATTTGGTTCTGAAATAAAGGCAAATGTGAGACGGAAGAGATACGCCATCCAGGGTTTGAAGTGGCAGCACAAGGACATCACATTTTGCATACAGAATTACACTCCCAAAATTGGCGAGTATTCTACCTATGAGGCGATTCGGAGAGCCTTTAAAGTTTGGGAGAGTGTGACGCCACTTCGCTTCCGGGAGGTTCGATATGTGGATATTAAAGATGGATACACTAAACATGCTGACATCATGCTTTTTTTTGCTGAGGGTTTTCATGGAGACAGCACTCCTTTTGATGGAGAGGGGGGCTTTTTGGCACATGCATATTTTCCTGGGTCAGGCATTGAAGGTGATACACACTTTGACTCTGCAGAACCTTGGACAGCTTAGAATGATGATCTTGAAAGGTATGAATCGGTTCCTGGTGGCTGGTCCATAACCTTTGGCCAGGCTCCTCGTTTTTGAAAATTCGAAAGAAACCACCTGCAAATTATGGCCTCCCTTTTTTTTCAATTTGAAGGAAACCCAAACTATTTTTTTCACCCCTCCACAAAAATAAAAA
Full Trace Sequence: CGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCCTCTGAGAGCAGCCTGGATTTGCCTGTTTCTGTGTTCTGTGTGCAGCTCCAACCCTTCCAAATTCAGCCCAGAGGCCTGGCTTCAACAGTATGGATATCTGCCCCCTGGAGATCTGCGGACACACACCTTACGCTCCCCTCAGTCCATGAGTGCTGCAGTCTCTGCCATGCAGAAGTTCTATGGCTTAAAAGTGACAGGAAAGTTTGACAGTGACACAGAGAAAGCAATGAAGAAGCCACGATGTGGAGTCCCTGACAAATTTGGTTCTGAAATAAAGGCAAATGTGAGACGGAAGAGATACGCCATCCAGGGTTTGAAGTGGCAGCACAAGGACATCACATTTTGCATACAGAATTACACTCCCAAAATTGGCGAGTATTCTACCTATGAGGCGATTCGGAGAGCCTTTAAAGTTTGGGAGAGTGTGACGCCACTTCGCTTCCGGGAGGTTCGATATGTGGATATTAAAGATGGATACACTAAACATGCTGACATCATGCTTTTTTTTGCTGAGGGTTTTCATGGAGACAGCACTCCTTTTGATGGAGAGGGGGGCTTTTTGGCACATGCATATTTTCCTGGGTCAGGCATTGAAGGTGATACACACTTTGACTCTGCAGAACCTTGGACAGCTTAGAATGATGATCTTGAAAGGTATGAATCGGTTCCTGGTGGCTGGTCCATAACCTTTGGCCAGGCTCCTCGTTTTTGAAAATTCGAAAGAAACCACCTGCAAATTATGGCCTCCCTTTTTTTTCAATTTGAAGGAAACCCAAACTATTTTTTTCACCCCTCCACAAAAATAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCCTCTGAGAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ838594
dbEST ID: 79656296
Trimmed Sequence: CACTTTATCCAGGAGGGACCGCTGCCAGTATAGAATCCTCTTCGGTGTGCCACATTGCCTGAAGAGCACAACAGCCAGTCCAAGGGTAAGAACACAAAGCAAGAGAATGACAGGAACTACAATGGCTGCAGCACTCACTTCACCACTTGCCTCGTCTACCTCAATAATAACCACCTCCCTGTCATCATCCTCTTCCGGCTGTCGGACAGTGCTGCAGCCCATCCAGTCGACCAAAACGGATTTCGGGTAGCCAGACTCTGTCTTCAGCTGCTGATTGTTGAACTTCCAATACTTGTTACCCTTGTAAAAGTAAGTGAAAGCTCCATCACTGCCCATGAATGCTCCTTTGATGGAGTCTGGGATGCCTTCCCACACGTTGACAGGTTTGGGGTATTCTGGATCCACTGCTCTCATCTCCTCGTTAAACCGGTAATACTTGGTACCCCTGAAGAAGTAGGTCTTTCCATTTGGCATCCAATATAGGGCAGCATCAATTCTGTCGCTAGGAAGTCCTCTGCCCATCTCCTTTCAGGGTTTTGGGATACCCTGGCTCTAAGACAGCTTCATCAAACACCCAGTGCTTATCCCCTTTGAAAAACACAAATTTGCCATCCTTTCGCTCATAAGCTGAATTAATGGAGCTGGGGAAGACACGCCCAGAATTTCCCCAATAGGCATAAGGGTATCCATCCCTTTACACCTTTTATTAACGTACACCCCCAGAACCCAGCCCTTCCCTTGAAAAACCAAAACATTCTCTTCCCCTTTAAACCACGCCAAT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTTATCCAGGAGGGACCGCTGCCAGTATAGAATCCTCTTCGGTGTGCCACATTGCCTGAAGAGCACAACAGCCAGTCCAAGGGTAAGAACACAAAGCAAGAGAATGACAGGAACTACAATGGCTGCAGCACTCACTTCACCACTTGCCTCGTCTACCTCAATAATAACCACCTCCCTGTCATCATCCTCTTCCGGCTGTCGGACAGTGCTGCAGCCCATCCAGTCGACCAAAACGGATTTCGGGTAGCCAGACTCTGTCTTCAGCTGCTGATTGTTGAACTTCCAATACTTGTTACCCTTGTAAAAGTAAGTGAAAGCTCCATCACTGCCCATGAATGCTCCTTTGATGGAGTCTGGGATGCCTTCCCACACGTTGACAGGTTTGGGGTATTCTGGATCCACTGCTCTCATCTCCTCGTTAAACCGGTAATACTTGGTACCCCTGAAGAAGTAGGTCTTTCCATTTGGCATCCAATATAGGGCAGCATCAATTCTGTCGCTAGGAAGTCCTCTGCCCATCTCCTTTCAGGGTTTTGGGATACCCTGGCTCTAAGACAGCTTCATCAAACACCCAGTGCTTATCCCCTTTGAAAAACACAAATTTGCCATCCTTTCGCTCATAAGCTGAATTAATGGAGCTGGGGAAGACACGCCCAGAATTTCCCCAATAGGCATAAGGGTATCCATCCCTTTACACCTTTTATTAACGTACACCCCCAGAACCCAGCCCTTCCCTTGAAAAACCAAAACATTCTCTTCCCCTTTAAACCACGCCAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTTATCCAGGAGGGAC