ORFeome > mmp2 ORF1 – XORFeome v1.0

mmp2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mmp2
Gene ID: 482845
Gene Page ID: 482840
ORF Xenbase ID: 17284365

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054947
Original XGC clone length: 1680

Human orthology & disease relationships

NCBI Entrez ID: 4313
Ensembl gene IDs: ENSG00000087245
Directly associated (OMIM) disease MIM numbers: 259600
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ839068
dbEST ID: 79656770
Trimmed Sequence: ATGCGGACAATTAAAATTATTAACGTTTTAGTATTCATTTTCAATAGTTTTAGTATATTTTATTATGTTTCCCCTGCTCCATCTCCTATCATAAAGTTTCCAGGAGACAAATCTCCAAAGACAGACGTGGAACTTGCTGCGCAATACCTGAATCAGTTTTATGGCTGCCCTAAGGAAAAATGTCACCTGATGGTTCTTAAGGATGCCCTAAAGAAAATGCAAAGTTTTTTTGGTCTTCCTGAAACTGGGGAGTTTGATCAAAATACCATTGAAACCATGAAAAAGCCAAGATGTGGGAACCCCGATGTAGCCAACTATAATTTCTTTCCCAGGAAACCGAAATGGGACAAAAACCATCTGACATACAGGATTCTTGGTTATACAACAGATCTGGATTCTGAAACAGTTGATGATGCTTTTGCACGTGCTTTTAAAGTTTGGAGTGATGTCACACCATTGGAATTTAACAGAATTCATGATGGAGAAGCAGATATCATGATCAATTTTGGACGATGGGAACATGGTGATGGATATCCATTTGATGGCAAAGATGGACTTCTGGCTCATGCATTTGCACCTGGATCAGGAGTTGGAGGCGATTCCCATTTTGACGATGATGAGCTTTGGACACTAGGAGAAGGCCAAGTTGTGAAAGTAAAGTATGGTAATGCAAGATGGAGAGGTCTGCAACTTTCCTTTCCTTTTTAATGATAAGGAATACAACAGTTTGCACTGAATTCTGGTCGCTCAAAATGGCCTCCCTTTGGGTGCCTCCACTAACATA
Full Trace Sequence: CCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGACAATTAAAATTATTAACGTTTTAGTATTCATTTTCAATAGTTTTAGTATATTTTATTATGTTTCCCCTGCTCCATCTCCTATCATAAAGTTTCCAGGAGACAAATCTCCAAAGACAGACGTGGAACTTGCTGCGCAATACCTGAATCAGTTTTATGGCTGCCCTAAGGAAAAATGTCACCTGATGGTTCTTAAGGATGCCCTAAAGAAAATGCAAAGTTTTTTTGGTCTTCCTGAAACTGGGGAGTTTGATCAAAATACCATTGAAACCATGAAAAAGCCAAGATGTGGGAACCCCGATGTAGCCAACTATAATTTCTTTCCCAGGAAACCGAAATGGGACAAAAACCATCTGACATACAGGATTCTTGGTTATACAACAGATCTGGATTCTGAAACAGTTGATGATGCTTTTGCACGTGCTTTTAAAGTTTGGAGTGATGTCACACCATTGGAATTTAACAGAATTCATGATGGAGAAGCAGATATCATGATCAATTTTGGACGATGGGAACATGGTGATGGATATCCATTTGATGGCAAAGATGGACTTCTGGCTCATGCATTTGCACCTGGATCAGGAGTTGGAGGCGATTCCCATTTTGACGATGATGAGCTTTGGACACTAGGAGAAGGCCAAGTTGTGAAAGTAAAGTATGGTAATGCAAGATGGAGAGGTCTGCAACTTTCCTTTCCTTTTTAATGATAAGGAATACAACAGTTTGCACTGAATTCTGGTCGCTCAAAATGGCCTCCCTTTGGGTGCCTCCACTAACATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGACAATTAAAATTATTAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839067
dbEST ID: 79656769
Trimmed Sequence: GGAGGTAGTCCTAAACTGGTCAACTTTTTTTGGGTAACCTCTTTCCAAAGTACTTGATGAGTAGACCCAATATTCATTACCTGCAAAAAAAACAGTCTTCTCTTCTTGAGGTTCTTCATAAACAGCATCAATCTTATCAGGTAGCTCAGGCCAGAAGGTAGCAATAAGTAGAGGTCCTGATGGTTTATTTCTTATGTTTGGAGTGCGCCATATAAATCTGTCTTTAAAAAAGAATGTTTCCCCTCTTATTTGAGACATGCCATCAAGTACAACATCTTTAGAGCACAGATCAGGGGTAACAGGGCCCATTGTTGGGATAGGTCCAGGACCTGGTTTTTCCTTGGATCCCTGACCATAGAGTTCTTGAATCCCAGTAATATCATCTTGTGAAAGCCGAAAGTTCTTTATGTATGTATAAATTGGAGCCATTAATGCTCCAGGATCCTGAGAGTGCTCTAGTCCTAAAGCATGACCAAATTCATGAGCAGCTACTAGGAAAAGACTGTAACCTTGATCAGGACAGAATCCCCACTTGCGATCATCATCATAGTTACTGCTTGATGCACACCATAGTTTTCCATCACTGCGACCAGAGCTGGTGCACGAATCATACTTGTTTCCCANGAAGGTGAAAGGAAAGACACATGGGGGAAACTTCAGCATTTTCCTCCAACAGTGGACAATGCTTGTTTCGGAACGAAAGCCGAACATCTTAACCCTTGTCCATAGTCCTTCGGGTGGTAGCCAAACCAACCTGGTAAGCCAATCCGGTT
Full Trace Sequence: CAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGGTAGTCCTAAACTGGTCAACTTTTTTTGGGTAACCTCTTTCCAAAGTACTTGATGAGTAGACCCAATATTCATTACCTGCAAAAAAAACAGTCTTCTCTTCTTGAGGTTCTTCATAAACAGCATCAATCTTATCAGGTAGCTCAGGCCAGAAGGTAGCAATAAGTAGAGGTCCTGATGGTTTATTTCTTATGTTTGGAGTGCGCCATATAAATCTGTCTTTAAAAAAGAATGTTTCCCCTCTTATTTGAGACATGCCATCAAGTACAACATCTTTAGAGCACAGATCAGGGGTAACAGGGCCCATTGTTGGGATAGGTCCAGGACCTGGTTTTTCCTTGGATCCCTGACCATAGAGTTCTTGAATCCCAGTAATATCATCTTGTGAAAGCCGAAAGTTCTTTATGTATGTATAAATTGGAGCCATTAATGCTCCAGGATCCTGAGAGTGCTCTAGTCCTAAAGCATGACCAAATTCATGAGCAGCTACTAGGAAAAGACTGTAACCTTGATCAGGACAGAATCCCCACTTGCGATCATCATCATAGTTACTGCTTGATGCACACCATAGTTTTCCATCACTGCGACCAGAGCTGGTGCACGAATCATACTTGTTTCCCANGAAGGTGAAAGGAAAGACACATGGGGGAAACTTCAGCATTTTCCTCCAACAGTGGACAATGCTTGTTTCGGAACGAAAGCCGAACATCTTAACCCTTGTCCATAGTCCTTCGGGTGGTAGCCAAACCAACCTGGTAAGCCAATCCGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGTAGTCCTAAACTGGTCAA