ORFeome > mmp7 ORF1 – XORFeome v1.0

mmp7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mmp7
Gene ID: 977273
Gene Page ID: 977267
ORF Xenbase ID: 17284383

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046939
Original XGC clone length: 780

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ824358
dbEST ID: 79642060
Trimmed Sequence: ATGCTCCAAGAATTCCTGTTAGTTTTCTTGGCACTGTCCTGTATCCAGGCCATGCCAATGCCCCAACCTGAAGATCCTATGAGCCCTTCGGAACGTATGTTTGCAGAGAAATACTTAGACACTTTCTATCAAATGAGGTCAAAGAACACTTTCGCTGAAAAACTCAAAGAGATGCAAAAGTTCTTTGGAATGTCGGTGACAGGGAGGTTGGACTCGGACACCATGAAGATGATGAAGACCCCTCGGTGCGGAATGCCCGATGTTGCAGAATTCCGACAGTTCCCTGGGAATCCCAGATGGTCAAAAGCGCAGCTGACTTACAGCATTGTGAATTACACTCCCGACCTGCGTCGCCAAGTGGTAGATGACGCCATCCAGAGGGCATTTGGGGTGTGGAGTAACGTGACCCCGCTGCAATTCACAAAAGTTTCCTCTGGAAATGCAGATATATTCATCCGATTCGGAGCACGCACGCATGGAGATTCCAACCCATTTGATGGCCCCAGTGGAGTTTTAGCTCACGCCTATGGTCCAGGGCGCGGCATTGGAGGTGATGCCCATTTTGATGAGGATGAAAGATGGACAAGTTCTAGAGCAGGTTTTAACTTGTTTCTAGTGGCTGCGCATGAATTTGGTCATTCTCTGGGACTTGATCATTCTACTGATCACAAAGCGTTGATGTTCCCAGCCNTACANTATGTGNAAACACATCCNTTCCGTTGTCACNAGATGACATTAACGGAATACAGTCATCCCATGGGGAGAAAGCAAAAGGCTTTTGCCACTTTTTCTTGTAAAAAATTTGGGCTTTTTAAGA
Full Trace Sequence: AATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCCAAGAATTCCTGTTAGTTTTCTTGGCACTGTCCTGTATCCAGGCCATGCCAATGCCCCAACCTGAAGATCCTATGAGCCCTTCGGAACGTATGTTTGCAGAGAAATACTTAGACACTTTCTATCAAATGAGGTCAAAGAACACTTTCGCTGAAAAACTCAAAGAGATGCAAAAGTTCTTTGGAATGTCGGTGACAGGGAGGTTGGACTCGGACACCATGAAGATGATGAAGACCCCTCGGTGCGGAATGCCCGATGTTGCAGAATTCCGACAGTTCCCTGGGAATCCCAGATGGTCAAAAGCGCAGCTGACTTACAGCATTGTGAATTACACTCCCGACCTGCGTCGCCAAGTGGTAGATGACGCCATCCAGAGGGCATTTGGGGTGTGGAGTAACGTGACCCCGCTGCAATTCACAAAAGTTTCCTCTGGAAATGCAGATATATTCATCCGATTCGGAGCACGCACGCATGGAGATTCCAACCCATTTGATGGCCCCAGTGGAGTTTTAGCTCACGCCTATGGTCCAGGGCGCGGCATTGGAGGTGATGCCCATTTTGATGAGGATGAAAGATGGACAAGTTCTAGAGCAGGTTTTAACTTGTTTCTAGTGGCTGCGCATGAATTTGGTCATTCTCTGGGACTTGATCATTCTACTGATCACAAAGCGTTGATGTTCCCAGCCNTACANTATGTGNAAACACATCCNTTCCGTTGTCACNAGATGACATTAACGGAATACAGTCATCCCATGGGGAGAAAGCAAAAGGCTTTTGCCACTTTTTCTTGTAAAAAATTTGGGCTTTTTAAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCCAAGAATTCCTGTTAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829717
dbEST ID: 79647419
Trimmed Sequence: AGCCTTTTGCCTTCTCCCATAGATTGACTGTATTCCGTTAATGTCATCTTGTGACAAACGGAAGGATGTGGTTTCCACATAATGGTAGGTTGGGAACATCAACGCTTGTGGATCAGTAGAATGATCAAGTCCCAGAGAATGACCAAATTCATGCGCAGCCACTAGAAACAAGTTAAAACCTGCTCTAGAACTTGTCCATCTTTCATCCTCATCAAAATGGGCATCACCTCCAATGCCGCGCCCTGGACCATAGGCGTGAGCTAAAACTCCACTGGGGCCATCAAATGGGTTGGAATCTCCATGCGTGCGTGCTCCGAATCGGATGAATATATCTGCATTTCCAGAGGAAACTTTTGTGAATTGCAGCGGGGTCACGTTACTCCACACCCCAAATGCCCTCTGGATGGCGTCATCTACCACTTGGCGACGCAGGTCGGGAGTGTAATTCACAATGCTGTAAGTCAGCTGCGCTTTTGACCATCTGGGATTCCCAGGGAACTGTCGGAATTCTGCAACATCGGGCATTCCGCACCGAGGGGTCTTCATCATCTTCATGGTGTCCGAGTCCAACCTCCCTGTCACCGACATTCCAAAGAACTTTTGCATCTCTTTGAGTTTTCAGCGAAAGTGTTCTTTTGACTCATTTTGATAGAAAGTGTCTAAATATTTCTCTGCAAACATAACTTTCCGAAGGGCTCATAAGAACCTTCCCGGTTGGGGGCATTTGGCATGGGCCGGGGAAAACGGGAAAGGGTGCCAAAAAA
Full Trace Sequence: GGCAGGGAACAGCTATGAACATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCCTTTTGCCTTCTCCCATAGATTGACTGTATTCCGTTAATGTCATCTTGTGACAAACGGAAGGATGTGGTTTCCACATAATGGTAGGTTGGGAACATCAACGCTTGTGGATCAGTAGAATGATCAAGTCCCAGAGAATGACCAAATTCATGCGCAGCCACTAGAAACAAGTTAAAACCTGCTCTAGAACTTGTCCATCTTTCATCCTCATCAAAATGGGCATCACCTCCAATGCCGCGCCCTGGACCATAGGCGTGAGCTAAAACTCCACTGGGGCCATCAAATGGGTTGGAATCTCCATGCGTGCGTGCTCCGAATCGGATGAATATATCTGCATTTCCAGAGGAAACTTTTGTGAATTGCAGCGGGGTCACGTTACTCCACACCCCAAATGCCCTCTGGATGGCGTCATCTACCACTTGGCGACGCAGGTCGGGAGTGTAATTCACAATGCTGTAAGTCAGCTGCGCTTTTGACCATCTGGGATTCCCAGGGAACTGTCGGAATTCTGCAACATCGGGCATTCCGCACCGAGGGGTCTTCATCATCTTCATGGTGTCCGAGTCCAACCTCCCTGTCACCGACATTCCAAAGAACTTTTGCATCTCTTTGAGTTTTCAGCGAAAGTGTTCTTTTGACTCATTTTGATAGAAAGTGTCTAAATATTTCTCTGCAAACATAACTTTCCGAAGGGCTCATAAGAACCTTCCCGGTTGGGGGCATTTGGCATGGGCCGGGGAAAACGGGAAAGGGTGCCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCCTTTTGCCTTCTCCC