ORFeome > mmp9 ORF1 – XORFeome v1.0

mmp9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mmp9
Gene ID: 876306
Gene Page ID: 876294
ORF Xenbase ID: 17284395

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057745
Original XGC clone length: 2016

Human orthology & disease relationships

NCBI Entrez ID: 4318
Ensembl gene IDs: ENSG00000100985
Directly associated (OMIM) disease MIM numbers: 613073
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ824718
dbEST ID: 79642420
Trimmed Sequence: ATGGGTAGGGTGGGAGTTTTAGTCTTAGTGACCATCCTTTGTTCCAAGGGTCACTCCGTTCCTATCGCCAGCAAGTCCCCTCTAACCATTTTATTTCCAGGGGACATCCAGAGTGGCACAACTGATATGGAACTGGCTGAGAGCTACCTCCTACAGTTTGGGTATCTTATCCAAGAACAGGGCTCAAATGCCACTTTACAAAATGCGCTCACCATTATGCAACAGAAACTGGGACTGAAGGAGACTGGAGTCCTAGATGCTGAAACACTGGAGGCCATGAAAAGACCTCGCTGTGGGGTTCCAGATATTGGACAATTCAACACATTTGAGGGGGATTTAAAGTGGGATCACAATGATATCACTTACCGTATTCTGAACTACTCCCCTGACCTGGACCCTGAAGTGATCGATGATGCCTTCGCCCGCGCATTCAAAGTCTGGAGTGATGTCACACCTCTGTCCTTCACTCGTATATACAGCGGGGAACCTGATATTAACATTCTGTTTGGGACTGAGGACCATGGGGATCCTTACCCCTTTGATAGGAAGGATGGTCTCTTGGCTCATGCTTACCCTCCTGGCCCTGGGGTGCAGGGTGATGCTCACTTTGATGATGATGAATTTTGGACACTGGGTACTGGAACTGTGGTAAAGACTCGCTTTTGGAATGCTGAAGGGGCTCTGTGTCGCTTCCATTCACATTTGATGGGACAGTCGTTCTCCACCTGTACAACTGCTGGACGCTCAGAATGGGGTGGCCTGTGGTGCAACACCCCCACCCAATTATGGAATAAGGAAAAAAAAAATACGGGCTTTTCGGGCCCCAGCCGAA
Full Trace Sequence: TATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAGGGTGGGAGTTTTAGTCTTAGTGACCATCCTTTGTTCCAAGGGTCACTCCGTTCCTATCGCCAGCAAGTCCCCTCTAACCATTTTATTTCCAGGGGACATCCAGAGTGGCACAACTGATATGGAACTGGCTGAGAGCTACCTCCTACAGTTTGGGTATCTTATCCAAGAACAGGGCTCAAATGCCACTTTACAAAATGCGCTCACCATTATGCAACAGAAACTGGGACTGAAGGAGACTGGAGTCCTAGATGCTGAAACACTGGAGGCCATGAAAAGACCTCGCTGTGGGGTTCCAGATATTGGACAATTCAACACATTTGAGGGGGATTTAAAGTGGGATCACAATGATATCACTTACCGTATTCTGAACTACTCCCCTGACCTGGACCCTGAAGTGATCGATGATGCCTTCGCCCGCGCATTCAAAGTCTGGAGTGATGTCACACCTCTGTCCTTCACTCGTATATACAGCGGGGAACCTGATATTAACATTCTGTTTGGGACTGAGGACCATGGGGATCCTTACCCCTTTGATAGGAAGGATGGTCTCTTGGCTCATGCTTACCCTCCTGGCCCTGGGGTGCAGGGTGATGCTCACTTTGATGATGATGAATTTTGGACACTGGGTACTGGAACTGTGGTAAAGACTCGCTTTTGGAATGCTGAAGGGGCTCTGTGTCGCTTCCATTCACATTTGATGGGACAGTCGTTCTCCACCTGTACAACTGCTGGACGCTCAGAATGGGGTGGCCTGTGGTGCAACACCCCCACCCAATTATGGAATAAGGAAAAAAAAAATACGGGCTTTTCGGGCCCCAGCCGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAGGGTGGGAGTTTTAG

Sequences - 3ʹ (reverse) EST

Accession: JZ830070
dbEST ID: 79647772
Trimmed Sequence: ATTCTGTGGGCAACGAAGGAGGTCATAGCTGACATATCCAACCATATCTTGTTGCTTTCGTGATGTCACACGCCAGAAGTATTGATCCTGGCAGAAGTAATAGTTTCCTTGATAGAGAAAAACATCATGGGAGTCACCCGGAACACCAGGATAGTTGTCAGCTGTCTGCCGTGGGTAGCCATTATCAATAGTCAATGTCTTTAGATTAAGCCTCCAGTATTGTTCTCCATTGAATAACAGGGCCTTTCCATTATCACGAGCAAAAGATCCCATGATAGCCTCCACATCCTTACTCAGACCCAACTTCTCGATGCTGCGTGGGCCTATAGCACTTGTACCTGTGTACTGCCAGAACTTGCTCCCTGAGAAGAAAAAAATGCTTTTGCTGGTGGGGTCCTGGAATGCAGTATCAATTTTGCTGGGGAGGGCTGGCCATGTATCTGAGATGCGCAGAGGAGACTGAGGAGAATTCTTACTTCTGGGAGTCAGAGTCCAATACAACCCATCTTTGAAGAAGTGAAGAGCTCCCTGTAGGTCTGCAATGGCATCAAACATCTCCACATTACAGGCATCTTGTGCCGGGTTCACTGGAGGTACAGGGTCTTGTGGTGGTTCTGGGACGTTTGGTAGCTAATGGGCTTCTTGGTGGGCCTTTGGTGGATGGGGGGTTTAGGAGGAGCGCCCTGGAACCTGTAACCATAATAGAAATTGGGATCCCCGCGCACCGTCATCTTTGATGAAAACTGGGGAAATCTTTTTCACAATAACCTTGATAA
Full Trace Sequence: AGAGAAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTGTGGGCAACGAAGGAGGTCATAGCTGACATATCCAACCATATCTTGTTGCTTTCGTGATGTCACACGCCAGAAGTATTGATCCTGGCAGAAGTAATAGTTTCCTTGATAGAGAAAAACATCATGGGAGTCACCCGGAACACCAGGATAGTTGTCAGCTGTCTGCCGTGGGTAGCCATTATCAATAGTCAATGTCTTTAGATTAAGCCTCCAGTATTGTTCTCCATTGAATAACAGGGCCTTTCCATTATCACGAGCAAAAGATCCCATGATAGCCTCCACATCCTTACTCAGACCCAACTTCTCGATGCTGCGTGGGCCTATAGCACTTGTACCTGTGTACTGCCAGAACTTGCTCCCTGAGAAGAAAAAAATGCTTTTGCTGGTGGGGTCCTGGAATGCAGTATCAATTTTGCTGGGGAGGGCTGGCCATGTATCTGAGATGCGCAGAGGAGACTGAGGAGAATTCTTACTTCTGGGAGTCAGAGTCCAATACAACCCATCTTTGAAGAAGTGAAGAGCTCCCTGTAGGTCTGCAATGGCATCAAACATCTCCACATTACAGGCATCTTGTGCCGGGTTCACTGGAGGTACAGGGTCTTGTGGTGGTTCTGGGACGTTTGGTAGCTAATGGGCTTCTTGGTGGGCCTTTGGTGGATGGGGGGTTTAGGAGGAGCGCCCTGGAACCTGTAACCATAATAGAAATTGGGATCCCCGCGCACCGTCATCTTTGATGAAAACTGGGGAAATCTTTTTCACAATAACCTTGATAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTGTGGGCAACGAAGG