ORFeome > mnat1 ORF1 – XORFeome v1.0

mnat1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mnat1
Gene ID: 876269
Gene Page ID: 876259
ORF Xenbase ID: 17284407

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054267
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID: 4331
Ensembl gene IDs: ENSG00000020426
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,151623,214150,216400,259500,601675,607136,609048

Library Location

Plate ID: GDExl11001
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ839204
dbEST ID: 79656906
Trimmed Sequence: ATGGATGACCAAGGCTGCCCGAGATGTAAAACCACCAAGTACAGGAACCCGTCTCTGAAACTGATGGTGAATGTGTGCGGACATACACTATGTGAAAGTTGTGTAGAGTTGTTGTTTGTAAGAGGGTCGGGTTCATGCCAGGAATGCGATACTCCACTTAGAAAAAGCAACTTTAAAGTCCAGCTCTTCGAAGATCCAACCATAGACAAAGAAGTGGAAATACGGAAGAAAATTCTGAAAATATACAATAAACGTGAAGAAGACTTTCCATCTCTAAGAGAATACAATGATTTTTTAGAAGAAATTGAAGAAATAGTGTTAAATTTGACCAACAATGTAGATCTTGACAATACCAGAAGAAAAATAGATATGTATCAAAAGGAAAACAAAGACACAATCCAAAGAAACAAGATAAAAATGACAAGGGAGCAAGAAGAACTGGAGGAAGCTTTGGAAATGGAGAAACATGAAAATGAGCAGAGGAGGCTTCATCTTCAGAAAGAAGAGCAATTCCAGCAAATGATGAAAAGAAAGAATAAGCAAGAACTCCTGGACCAGCTGGAAACCTCTCACCTTCCTGCCTCTATCCTCCTGGCACAACACAAGGGCAAGTCAGTGCAAGCTGAAATGCAGGTGGAAAACCCAAGATCCTTTTAGAACGATACATTTTTCACTGGCATCAAGAAAGGGTCACCACTTTGCTTCTGTGTCCCATTACCAAAAATTGAAAAAGGCTTTAATTTTCATTAACCAACCCTAATTCCCAATTTAAAACCTTAACGGCC
Full Trace Sequence: CCTCGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGACCAAGGCTGCCCGAGATGTAAAACCACCAAGTACAGGAACCCGTCTCTGAAACTGATGGTGAATGTGTGCGGACATACACTATGTGAAAGTTGTGTAGAGTTGTTGTTTGTAAGAGGGTCGGGTTCATGCCAGGAATGCGATACTCCACTTAGAAAAAGCAACTTTAAAGTCCAGCTCTTCGAAGATCCAACCATAGACAAAGAAGTGGAAATACGGAAGAAAATTCTGAAAATATACAATAAACGTGAAGAAGACTTTCCATCTCTAAGAGAATACAATGATTTTTTAGAAGAAATTGAAGAAATAGTGTTAAATTTGACCAACAATGTAGATCTTGACAATACCAGAAGAAAAATAGATATGTATCAAAAGGAAAACAAAGACACAATCCAAAGAAACAAGATAAAAATGACAAGGGAGCAAGAAGAACTGGAGGAAGCTTTGGAAATGGAGAAACATGAAAATGAGCAGAGGAGGCTTCATCTTCAGAAAGAAGAGCAATTCCAGCAAATGATGAAAAGAAAGAATAAGCAAGAACTCCTGGACCAGCTGGAAACCTCTCACCTTCCTGCCTCTATCCTCCTGGCACAACACAAGGGCAAGTCAGTGCAAGCTGAAATGCAGGTGGAAAACCCAAGATCCTTTTAGAACGATACATTTTTCACTGGCATCAAGAAAGGGTCACCACTTTGCTTCTGTGTCCCATTACCAAAAATTGAAAAAGGCTTTAATTTTCATTAACCAACCCTAATTCCCAATTTAAAACCTTAACGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGACCAAGGCTGCCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839203
dbEST ID: 79656905
Trimmed Sequence: ATGTGTCTGCCAGAATAGTCCGCTAAAGGCGTCCTGTAGTGCCCTGTGGCAGGCAAGAGAGGAAACGTAGCCTCCGGCTAAATCCTGCGGGGCGGCAGCTCGTACATGGTTCAGATACCCTTGCCTTCCCAGCATTTCTATGTGTGGAACTTGTGGGCCGTAAGTTTCAATGTGAATAGGCTGGTACTGATATAAAGCCTCTTCAATCTTCGTAACTGGCACAGAAGCAATGTGGTGACCTTTCTTGATGCCAGTGGAAAATGTATCGGTCTTAAAGGATCTTGGCTTTTCCACCTGCATTTCAGCTTGCACTGACTTGCCCTTGTGTTGTGCCAGGAGGATAGAGGCAGGAAGGTGAGAGGTTTCCAGCTGGTCCAGGAGTTCTTGCTTATTCTTTCTTTTCATCATTTGCTGGAATTGCTCTTCTTTCTGAAGATGAAGCCTCCTCTGCTCATTTTCATGTTTCTCCATTTCCAAAGCTTCCTCCAGTTCTTCTTGCTCCCTTGTCATTTTTATCTTGTTTCTTTGGATTGTGTCTTTGTTTTCCTTTTGATACATATCTATTTTTCTTCTGGTATTGTCAAGATCTACATTGGTGGTCAGATTTACCACTATTTCTTCCATTTCTTCTTAAAAATTCATTGTAATCTCTTAGAAAATGGAAAGTCCTTCCTTCACGTTTAATTGTTATATTTTTCCAAAATTTTTCTTTCCCTTATTTTCCCACTTTCTTTTGGTTTAT
Full Trace Sequence: CGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTGTCTGCCAGAATAGTCCGCTAAAGGCGTCCTGTAGTGCCCTGTGGCAGGCAAGAGAGGAAACGTAGCCTCCGGCTAAATCCTGCGGGGCGGCAGCTCGTACATGGTTCAGATACCCTTGCCTTCCCAGCATTTCTATGTGTGGAACTTGTGGGCCGTAAGTTTCAATGTGAATAGGCTGGTACTGATATAAAGCCTCTTCAATCTTCGTAACTGGCACAGAAGCAATGTGGTGACCTTTCTTGATGCCAGTGGAAAATGTATCGGTCTTAAAGGATCTTGGCTTTTCCACCTGCATTTCAGCTTGCACTGACTTGCCCTTGTGTTGTGCCAGGAGGATAGAGGCAGGAAGGTGAGAGGTTTCCAGCTGGTCCAGGAGTTCTTGCTTATTCTTTCTTTTCATCATTTGCTGGAATTGCTCTTCTTTCTGAAGATGAAGCCTCCTCTGCTCATTTTCATGTTTCTCCATTTCCAAAGCTTCCTCCAGTTCTTCTTGCTCCCTTGTCATTTTTATCTTGTTTCTTTGGATTGTGTCTTTGTTTTCCTTTTGATACATATCTATTTTTCTTCTGGTATTGTCAAGATCTACATTGGTGGTCAGATTTACCACTATTTCTTCCATTTCTTCTTAAAAATTCATTGTAATCTCTTAGAAAATGGAAAGTCCTTCCTTCACGTTTAATTGTTATATTTTTCCAAAATTTTTCTTTCCCTTATTTTCCCACTTTCTTTTGGTTTAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGTCTGCCAGAATAGTCC