ORFeome > mnx1 ORF1 – XORFeome v1.0

mnx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mnx1
Gene ID: 1113190
Gene Page ID: 919889
ORF Xenbase ID: 17284431

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108589
Original XGC clone length: 1002

Human orthology & disease relationships

NCBI Entrez ID: 3110
Ensembl gene IDs: ENSG00000130675
Directly associated (OMIM) disease MIM numbers: 176450
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837928
dbEST ID: 79655630
Trimmed Sequence: ATGGAGAAGTCCAAGAATTTCAGGATTGACGCTCTCCTGGCGATAGATCCCCCCAAGGCTCAGACCTCCCCATTGGCTCTGGTCACCTCGCTGTCCTCCTCGTCTCTCTCCGGGAGCCCCCCGTCCGAGCACACTGACAGCCTCAGGACTGACTCCCCCTCCCCTCCAAGGACTTGTGGACTGGTCCCTAAACCAGGTTTCCTGAGCAGCCACCAGCACCCCCCAAACATGATGTCATTGCACCCCCAGGCTGCTCCAGGGATCCCCCCTCAGGCCCTGTATGGACACCCGATGTACAGCTACTTGGCAGCGGGGCAGCACCCAGCTCTGTCCTACCCCTACTCCCAGATGCAGAGCAGCCACCACCCCCACCCCATGGACCCCATCAAGATCAGCGCTGGCACCTTCCAACTGGACCAGTGGCTCAGAGCCTCCACTGCCGGCATGATGCTGCCCAAAATGGCAGACTTTAACTCCCAGGCCCAATCCAACCTGCTGGGAAAGTGCAGAAGACCAAGGACAGCGTTTACCAGTCAGCAGCTGTTGGAACTGGAGCACCAATTCAAGCTGAACAAGGTACCTCTCCAGGCCGAAACGCTTTTGAAGTGGCCACTTCCCTGATGCTCACTGAGACGCAAGGTGAAGAATCTGGTTCCGAAACAGCCGCAGAAAATGGAAAAAGAGTAAAAAAGCCCAAGGAAGAGGGGGGCCGAGGAACTCCGCAAAAGAAAAAACAAAAAGGCAGGGCAGGGGCCGGCAGCCAGGAGAAAAGGGCCTCGGAAAGAAACCTGCAGGGAAAGAAAAAAAAAAATCCTAAACCAACTCCCCCT
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAAGTCCAAGAATTTCAGGATTGACGCTCTCCTGGCGATAGATCCCCCCAAGGCTCAGACCTCCCCATTGGCTCTGGTCACCTCGCTGTCCTCCTCGTCTCTCTCCGGGAGCCCCCCGTCCGAGCACACTGACAGCCTCAGGACTGACTCCCCCTCCCCTCCAAGGACTTGTGGACTGGTCCCTAAACCAGGTTTCCTGAGCAGCCACCAGCACCCCCCAAACATGATGTCATTGCACCCCCAGGCTGCTCCAGGGATCCCCCCTCAGGCCCTGTATGGACACCCGATGTACAGCTACTTGGCAGCGGGGCAGCACCCAGCTCTGTCCTACCCCTACTCCCAGATGCAGAGCAGCCACCACCCCCACCCCATGGACCCCATCAAGATCAGCGCTGGCACCTTCCAACTGGACCAGTGGCTCAGAGCCTCCACTGCCGGCATGATGCTGCCCAAAATGGCAGACTTTAACTCCCAGGCCCAATCCAACCTGCTGGGAAAGTGCAGAAGACCAAGGACAGCGTTTACCAGTCAGCAGCTGTTGGAACTGGAGCACCAATTCAAGCTGAACAAGGTACCTCTCCAGGCCGAAACGCTTTTGAAGTGGCCACTTCCCTGATGCTCACTGAGACGCAAGGTGAAGAATCTGGTTCCGAAACAGCCGCAGAAAATGGAAAAAGAGTAAAAAAGCCCAAGGAAGAGGGGGGCCGAGGAACTCCGCAAAAGAAAAAACAAAAAGGCAGGGCAGGGGCCGGCAGCCAGGAGAAAAGGGCCTCGGAAAGAAACCTGCAGGGAAAGAAAAAAAAAAATCCTAAACCAACTCCCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAAGTCCAAGAATTTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837927
dbEST ID: 79655629
Trimmed Sequence: GTGGCCGCTCTGCTTATTGTGGCTGTTCTCCTCTTCCTCGGATGTGCAGTCAGAAGAATGATGGTAAAACCGCTTCCCCTCCCCTCTGTGATCTTCCTCTTCCTCCTCTTCCCTGTCCTCCTCCTCGTCCTCTTCGCTGTCTGTATAGTCTCTGGGCTGCAGGCGGCCGTTCCCTTTGATGGGCTCCCCCCTGGGATGGAGATGGTAGGATTTCTTCTCTTCCTGCAGCTCATCCGAGCACTTCTCCTCGCTGCTGCCCTTGCCTGCCCTCTGCTGTTTCTCTGCTGAGTCCTGCGCCGCCTGCTCCTTGGCTTTCTTACTCCTCTTCCATTTCATGCGCCTGTTCTGGAACCAGATCTTCACCTGCGTCTCAGTGAGCATCAGGGAAGTGGCCACTTCAAAGCGTTTCGGCCTGGAGAGGTACTTGTTCAGCTTGAATTGGTGCTCCAGTTCCAACAGCTGCTGACTGGTAAACGCTGTCCTTGGTCTTCTGCACTTTCCCAACAGGTTGGATTGGGCCTGGGAGTTAAAGTCTGCCATTTTGGGCAGCATCATGCCGGCAGTGGAGGCTCTGAGCCACTGGTCCAGTTGGAAAGTGCCAGCGCTGATCTTGATGGGGTCCTGGGGGTGGGGGGTGGGGGCGGGTCTGCATCCGGGCAAAAAGAATAAGAACAAAACGGGGTAGTGCGCGGCGGGCGGAAAGACTTTTAAATCAAATTTTCCCTTAACAGGCCCCAAAACGGCGCAATCCCCTTGAACCCCACCCGGGG
Full Trace Sequence: AAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGCCGCTCTGCTTATTGTGGCTGTTCTCCTCTTCCTCGGATGTGCAGTCAGAAGAATGATGGTAAAACCGCTTCCCCTCCCCTCTGTGATCTTCCTCTTCCTCCTCTTCCCTGTCCTCCTCCTCGTCCTCTTCGCTGTCTGTATAGTCTCTGGGCTGCAGGCGGCCGTTCCCTTTGATGGGCTCCCCCCTGGGATGGAGATGGTAGGATTTCTTCTCTTCCTGCAGCTCATCCGAGCACTTCTCCTCGCTGCTGCCCTTGCCTGCCCTCTGCTGTTTCTCTGCTGAGTCCTGCGCCGCCTGCTCCTTGGCTTTCTTACTCCTCTTCCATTTCATGCGCCTGTTCTGGAACCAGATCTTCACCTGCGTCTCAGTGAGCATCAGGGAAGTGGCCACTTCAAAGCGTTTCGGCCTGGAGAGGTACTTGTTCAGCTTGAATTGGTGCTCCAGTTCCAACAGCTGCTGACTGGTAAACGCTGTCCTTGGTCTTCTGCACTTTCCCAACAGGTTGGATTGGGCCTGGGAGTTAAAGTCTGCCATTTTGGGCAGCATCATGCCGGCAGTGGAGGCTCTGAGCCACTGGTCCAGTTGGAAAGTGCCAGCGCTGATCTTGATGGGGTCCTGGGGGTGGGGGGTGGGGGCGGGTCTGCATCCGGGCAAAAAGAATAAGAACAAAACGGGGTAGTGCGCGGCGGGCGGAAAGACTTTTAAATCAAATTTTCCCTTAACAGGCCCCAAAACGGCGCAATCCCCTTGAACCCCACCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCCGCTCTGCTTATT