ORFeome > mogat1 ORF2 – XORFeome v1.0

mogat1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mogat1
Gene ID: 1004231
Gene Page ID: 1004225
ORF Xenbase ID: 17284497

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106627
Original XGC clone length: 1008

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ837657
dbEST ID: 79655359
Trimmed Sequence: ATGAAGGTTGAATTTGCTCCTCTCAATATACCCCTGGCCCGGAGGTTGCAGACAACTGCTGTGTTCCAGTGGGTATTCTCCTTTCTGTTACTATCACAGTGCTGTATAGGGATATTTATCTGTCCGGTGCGGGCAAGAAAATGGCTCCTTTTCACTCTAAATAGGTTGTTGAGGCCTTTTCACTGGGAAACCCCCCAACCGGCCGAAGGAGGAAGATGGCAGTGATGGCAGAACTGCCAAGCAGGGAAGTAATTATCTGCAATTTTTCCAAACTGGCTTTAAAAACCATGCGATTTACACCCCCCCCACCATTAAAACAGGCGTTTTCCACCCCTTTGAGATATTGGTACGGGGACACATTGAGAAAATCTCGGAAAAAAAAAACCGTGTTTAAAAGAAAGTCGTCTTTTAAATATCCCCCTTAGGGAAAAGGGTGCGGCTCTTCAGGAAAAAGAGGCGCATTATTCCCCAAGACCCCTCCCACAAAAAAAAATAAATAGTCCCCCCCCCCCAAAAAAAAAAAAAGAGGTGGGCCTCTCTTTTTTCAAGGGGGGAGAAAGGAAAATTCTCTCTTTATTTTTGCTCCTGAGAGAAGAAACAAACAAACATCTCCAAAGGCCGCAAAAGTGGAAGAAAAAGTGGGTCCCCAAAAAAAACAGCAGGAAACAAAGAACAGAACTTTTTTTTTTTTGGCGATAAAATAAAAAG
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTTGAATTTGCTCCTCTCAATATACCCCTGGCCCGGAGGTTGCAGACAACTGCTGTGTTCCAGTGGGTATTCTCCTTTCTGTTACTATCACAGTGCTGTATAGGGATATTTATCTGTCCGGTGCGGGCAAGAAAATGGCTCCTTTTCACTCTAAATAGGTTGTTGAGGCCTTTTCACTGGGAAACCCCCCAACCGGCCGAAGGAGGAAGATGGCAGTGATGGCAGAACTGCCAAGCAGGGAAGTAATTATCTGCAATTTTTCCAAACTGGCTTTAAAAACCATGCGATTTACACCCCCCCCACCATTAAAACAGGCGTTTTCCACCCCTTTGAGATATTGGTACGGGGACACATTGAGAAAATCTCGGAAAAAAAAAACCGTGTTTAAAAGAAAGTCGTCTTTTAAATATCCCCCTTAGGGAAAAGGGTGCGGCTCTTCAGGAAAAAGAGGCGCATTATTCCCCAAGACCCCTCCCACAAAAAAAAATAAATAGTCCCCCCCCCCCAAAAAAAAAAAAAGAGGTGGGCCTCTCTTTTTTCAAGGGGGGAGAAAGGAAAATTCTCTCTTTATTTTTGCTCCTGAGAGAAGAAACAAACAAACATCTCCAAAGGCCGCAAAAGTGGAAGAAAAAGTGGGTCCCCAAAAAAAACAGCAGGAAACAAAGAACAGAACTTTTTTTTTTTTGGCGATAAAATAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTTGAATTTGCTCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837656
dbEST ID: 79655358
Trimmed Sequence: TATGAATATGAGGGATTCGTGTTCAGGGATTCCATATCTTTTCTTGTGTTCCTCAAAGAGTTCTTGCAGCGCACCGAGGTACTGCTGATGAAGTGATTCAATTTCCTCTTGTGTAGGGTGGGATGTTTCCTTTACTGGGATAGGACGACCCACAACAGTATGGATAGGCATCCTGTATGGCATCAGGCCAAAGCTGTACTGGAAGATTCCTCGAGCATGAAAGAGTGGCATAGCAAGCCCCATGATCCTCTGAAGCCTCTCCTGGACACAGCGAAGTAATGATCCTTTTGGATTTGACACCTGCTGAAACAGTTCATTCTCCCCAAAAGAGAACACTGGTACCAGGTAAGCCCCTCTTTTGAGCGCCACTTTGATGAATCCTTTCCGCTTCAGGATGTTAAGGGTTAGACTTCCAGGATGGGCGTCCAACGATTCCTCTGCTCCCCCAGTGACAATAATAGAAACGTTGCCGCCATCCTCTTTGCTCACAACATGGTTGACACTCTTCTTGGAGGCAGAGACCAATCCCACGCTCATGATGTATTCTCGGAAGAACGGGCACCTGAACCAGAAAGGCAGAAGGTGCAGGTAGGGGGTAAGTCCAGGAAACAATTCCTTAAAGCCAGTGTAGTTAGTAAAGAGGTTGGCCAAGGCCCCGGCGACCAAGTACTCCCTGTTGGTGGAAGGCCATGAATATAATGGGGTTGGGGGAGGTAATGACAAGGTTTTGCGGGCCCGGATTGAAGAATAATCCTTGAAAATAACTTCCTTCGGGGGGAGTTGCGGTGCGCGCTCGCCTCCTTCTTCTCCCCCCCGGTGGGGGTGTCCCGGTCGGGATAGAGGCAGAGGACCCTCTAAACCTGACGGAAGGGGATTTGTTTGCGCCGCCGGCGGGATAAAATTCCCCTTAAGCCCTTTTCCTTTTAGCCGGAAAGAAGAGAGCCAGGGAAAAAAGGGGAATAGCTGGGGGGCCCCGGGGGCGGGGGGGAAAGTGGAAGAAGAAAAGATTACCCACTAATGTTCTCCCCGGTGTTTGTTACGAGGGTGTTGGTGGGTGCAAGGAGGGGTTTGGTGAAAATTAGAAAAAAAAAAAAGAAAAAAAAAAAGAAAATAAAAAAAGAAAAAAGAAAACTTAATTTTTTTGGTTGGCGGCCCGGAA
Full Trace Sequence: TGGCAGGGAACCGCCACTGAACAAGGTAAAACGAACCACACAAGGGGGAGCCCAGCCGGGACGGCAAAAATGAATTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATGAATATGAGGGATTCGTGTTCAGGGATTCCATATCTTTTCTTGTGTTCCTCAAAGAGTTCTTGCAGCGCACCGAGGTACTGCTGATGAAGTGATTCAATTTCCTCTTGTGTAGGGTGGGATGTTTCCTTTACTGGGATAGGACGACCCACAACAGTATGGATAGGCATCCTGTATGGCATCAGGCCAAAGCTGTACTGGAAGATTCCTCGAGCATGAAAGAGTGGCATAGCAAGCCCCATGATCCTCTGAAGCCTCTCCTGGACACAGCGAAGTAATGATCCTTTTGGATTTGACACCTGCTGAAACAGTTCATTCTCCCCAAAAGAGAACACTGGTACCAGGTAAGCCCCTCTTTTGAGCGCCACTTTGATGAATCCTTTCCGCTTCAGGATGTTAAGGGTTAGACTTCCAGGATGGGCGTCCAACGATTCCTCTGCTCCCCCAGTGACAATAATAGAAACGTTGCCGCCATCCTCTTTGCTCACAACATGGTTGACACTCTTCTTGGAGGCAGAGACCAATCCCACGCTCATGATGTATTCTCGGAAGAACGGGCACCTGAACCAGAAAGGCAGAAGGTGCAGGTAGGGGGTAAGTCCAGGAAACAATTCCTTAAAGCCAGTGTAGTTAGTAAAGAGGTTGGCCAAGGCCCCGGCGACCAAGTACTCCCTGTTGGTGGAAGGCCATGAATATAATGGGGTTGGGGGAGGTAATGACAAGGTTTTGCGGGCCCGGATTGAAGAATAATCCTTGAAAATAACTTCCTTCGGGGGGAGTTGCGGTGCGCGCTCGCCTCCTTCTTCTCCCCCCCGGTGGGGGTGTCCCGGTCGGGATAGAGGCAGAGGACCCTCTAAACCTGACGGAAGGGGATTTGTTTGCGCCGCCGGCGGGATAAAATTCCCCTTAAGCCCTTTTCCTTTTAGCCGGAAAGAAGAGAGCCAGGGAAAAAAGGGGAATAGCTGGGGGGCCCCGGGGGCGGGGGGGAAAGTGGAAGAAGAAAAGATTACCCACTAATGTTCTCCCCGGTGTTTGTTACGAGGGTGTTGGTGGGTGCAAGGAGGGGTTTGGTGAAAATTAGAAAAAAAAAAAAGAAAAAAAAAAAGAAAATAAAAAAAGAAAAAAGAAAACTTAATTTTTTTGGTTGGCGGCCCGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGAATATGAGGGATTCGTGTTC