ORFeome > morn2 ORF1 – XORFeome v1.0

morn2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: morn2
Gene ID: 5871528
Gene Page ID: 5871526
ORF Xenbase ID: 17284539

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC141735
Original XGC clone length: 240

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838888
dbEST ID: 79656590
Trimmed Sequence: ATGAATGGCACCGGAAAACTTGAACATCCATCAGGAGCAGTTTATGAAGGAGAATTTACTGATAATATGTTTCATGGGAATGGTACATACATTTTCCCAAATGGAGCCAGATATATAGGAATCTTTAACCAGAACAGAATGGAGGGAGAAGGTGAATACGTGGATGCACACGGACTGCAATGGAGAGGAATGTTTCATTATAAAGTAGCACCAGGATTAAAATTAAAGCTGCAAATATT
Full Trace Sequence: GGGCGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATGGCACCGGAAAACTTGAACATCCATCAGGAGCAGTTTATGAAGGAGAATTTACTGATAATATGTTTCATGGGAATGGTACATACATTTTCCCAAATGGAGCCAGATATATAGGAATCTTTAACCAGAACAGAATGGAGGGAGAAGGTGAATACGTGGATGCACACGGACTGCAATGGAGAGGAATGTTTCATTATAAAGTAGCACCAGGATTAAAATTAAAGCTGCAAATATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCACGAGACACAAAATCTCTGATGTTACAGACACTTCGAAACTGCAAGGGAAAGAAAAAACAAAAGGCTCCGCTGCCCAACGGGGCCGTTCGACGCGAATCTGGTTATCCGAAGAAGCCCTAATCCCCAGGAAAATAACCCGGTGGAGCTCATAAGTGGAAATGAAGTAACGGCCCGGCCCGCGCACCTTGAACAAAACCCTGGCCCGAGTCCAAAATGGGTAACGGGCAAGGGCGGCTTTTTTGGGCTTTTTATAACGGTTTTTTGAAAGTCTTTTCCAGAGCCCGGGCCGCGGGGGGCAACACGCCGGTACCCGCCGGGTTTTAATTTTTGTGTGGTGGTAATACACAGTGTATTTTTTATCGTGGACGAGACGAGACTCCTCCTGCGCCCCAACCGTAGATATCTCTAACGAAGGGGGAACAGGGGGGCGTGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGGCACCGGAAAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838887
dbEST ID: 79656589
Trimmed Sequence: TATTTGCAGCTTTAATTTTAATCCTGGTGCTACTTTATAATGAAACATTCCTCTCCATTGCAGTCCGTGTGCATCCACGTATTCACCTTCTCCCTCCATTCTGTTCTGGTTAAAGATTCCTATATATCTGGCTCCATTTGGGAAAATGTATGTACCATTCCCATGAAACATATTATCAGTAAATTCTCCTTCATAAACTGCTCCTGATGGATGTTCAAGTTTTCCGGTGCCATTCATGG
Full Trace Sequence: GCGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTTGCAGCTTTAATTTTAATCCTGGTGCTACTTTATAATGAAACATTCCTCTCCATTGCAGTCCGTGTGCATCCACGTATTCACCTTCTCCCTCCATTCTGTTCTGGTTAAAGATTCCTATATATCTGGCTCCATTTGGGAAAATGTATGTACCATTCCCATGAAACATATTATCAGTAAATTCTCCTTCATAAACTGCTCCTGATGGATGTTCAAGTTTTCCGGTGCCATTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGAAGAAGAATTACAACGTCACTTACAGAGACACAAGGAAACGGAAGACAAACAAATACCTGAAAGTCCAGCTAAAAAATGGGGCCGGCTGTGCCTACGTTTAATACGAAAAAGGGCGCATCGAAAGGTACAAACCCTGGTCACTTTTTAGATTTTATGAGGTAGCACATCCCCTGGGGGAGGGGCACAAACCGTGAGCAAAACATCGGTGGGACGGGCGCAAGGGGGGTTCAAGGCTTGTCAGAACTTTTTTTGGGTTACGTCTCCCCTGGGGAATTCAGCCGCAAGCCAGTTACCGTGCGGTTGGGGGTAAAAGGTAANNNCNNNNNNGANTGNAGGCCANNAAANNNGNNGGCNANNAGNNNGAANAAAAATTTTNAAAGAGGNNNGTGNGNANNNANAAATGNNAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTTGCAGCTTTAATTTTAATCC