ORFeome > mospd1 ORF1 – XORFeome v1.0

mospd1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mospd1
Gene ID: 877109
Gene Page ID: 877097
ORF Xenbase ID: 17284551

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054306
Original XGC clone length: 648

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ839562
dbEST ID: 79657264
Trimmed Sequence: ATGCAGCAGCAAAAACGGCAGCCAGAGCTAGTGGAAGGAAACCTTCCAGTTTTTGTCTTTCCAACAGAGCTTATATTTTATGCCGATGATCAGTCTACGCACAAGCAGGTGTTAACCTTGTACAACCCTTATGAGTTCGCTTTAAAATTTAAAGTTCTCTGTACGTCTCCCAATAAGTACGTTGTAGTGGATGCTGCAGGGGCAGTGAAACCTCAGTGCTGCGTTGATATTGTTATACGGCACAAAGATGTCCGAGCCAGTCACTTTGGCGTCATTGACAAATTCCGTCTTCAAGTATCCGAACAAAGTCAAAGGAAAGCGCTGGGACGCAAAGAAGTCATAGCAATGCTGCTTCCATCTGCAAAGGAGCAACAGCAAAAGGAAGAGGAAGAAAAGAGAATGAAGGAACATTTTGCAGAAAGTGTCTTCTTTGAACAGGCACCTTCCCAACCAGATGCCAGAAATTCTTCCTCAGGACCTAGTCTGCTGATGGTCTTCCTTGGCATGGTTTGCATTGCTGCACTGATGATGCCCACCTTGGGTGAGATTGAATCCATGGTGCCTCTCTACCTCCACTTAAGTGTGAATCAGAAATTAGTGGCCGCCTATGTTTTAGGACTTGTAAACAATGGTTGTTTTGCGAACCTT
Full Trace Sequence: GCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCAGCAAAAACGGCAGCCAGAGCTAGTGGAAGGAAACCTTCCAGTTTTTGTCTTTCCAACAGAGCTTATATTTTATGCCGATGATCAGTCTACGCACAAGCAGGTGTTAACCTTGTACAACCCTTATGAGTTCGCTTTAAAATTTAAAGTTCTCTGTACGTCTCCCAATAAGTACGTTGTAGTGGATGCTGCAGGGGCAGTGAAACCTCAGTGCTGCGTTGATATTGTTATACGGCACAAAGATGTCCGAGCCAGTCACTTTGGCGTCATTGACAAATTCCGTCTTCAAGTATCCGAACAAAGTCAAAGGAAAGCGCTGGGACGCAAAGAAGTCATAGCAATGCTGCTTCCATCTGCAAAGGAGCAACAGCAAAAGGAAGAGGAAGAAAAGAGAATGAAGGAACATTTTGCAGAAAGTGTCTTCTTTGAACAGGCACCTTCCCAACCAGATGCCAGAAATTCTTCCTCAGGACCTAGTCTGCTGATGGTCTTCCTTGGCATGGTTTGCATTGCTGCACTGATGATGCCCACCTTGGGTGAGATTGAATCCATGGTGCCTCTCTACCTCCACTTAAGTGTGAATCAGAAATTAGTGGCCGCCTATGTTTTAGGACTTGTAAACAATGGTTGTTTTGCGAACCTTGCCCACTTTCTTGTACAAAGTTGGGCTTAATAAAAAGCATTGCTTTACCATTTTTTGCCACGAACAGGTTCACATCAATTCCAATTAAAATCCTTTATTTAACAATCAAAAACAAAAAAAAAAAAAAAATGAAATCTATTAAAAAAAAGGAAATAATTCTGTATTTCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCAGCAAAAACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839561
dbEST ID: 79657263
Trimmed Sequence: TGTTCGCAAAACAACCATTGTTACAAGTCCTAAAACATAGGCGGCCACTAATTTCTGATTCACACTTAAGTGGAGGTAGAGAGGCACCATGGATTCAATTTCACCCAAGGTGGGCATCATCAGTGCAGCAATGCAAACCATGCCAAGGAAGACCATCAGCAGACTAGGTCCTGAGGAAGAATTTCTGGCATCTGGTTGGGAAGGTGCCTGTTCAAAGAAGACACTTTCTGCAAAATGTTCCTTCATTCTCTTTTCTTCCTCTTCCTTTTGCTGTTGCTCCTTTGCAGATGGAAGCAGCATTGCTATGACTTCTTTGCGTCCCAGCGCTTTCCTTTGACTTTGTTCGGATACTTGAAGACGGAATTTGTCAATGACGCCNAAGTGACTGGCTCGGACATCTTTGTGCCGTATAACAATATCAACGCAGCACTGAGGTTTCACTGCCCCTGCAGCATCCACTACAACGTACTTATTGGGAGACGTACAGAGAAATTTAAATTTTAAAGCGAACTCATAAGGGTTGTACAAGGTTAACACCTGCTTGTGCGTAGAAAGAATATCCGGCATAAATAATAACCTCTGTTGAAAAAACAAAAACTGGAAGGTTCCCTTCCCACTAGCTCTGGGCGCCCGTTTTTTCCTGCTGCCATGGGTCCCAACTTTTTTTGGACAAAGTTTGTCATTATTTAAAAAAACAATTGCCTCATCCAATTTTGTTTGCAAACCAAACCAAGGAAAAAAAAAACAAAAAAAAAAAAAAAAAAAATAA
Full Trace Sequence: GAAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTCGCAAAACAACCATTGTTACAAGTCCTAAAACATAGGCGGCCACTAATTTCTGATTCACACTTAAGTGGAGGTAGAGAGGCACCATGGATTCAATTTCACCCAAGGTGGGCATCATCAGTGCAGCAATGCAAACCATGCCAAGGAAGACCATCAGCAGACTAGGTCCTGAGGAAGAATTTCTGGCATCTGGTTGGGAAGGTGCCTGTTCAAAGAAGACACTTTCTGCAAAATGTTCCTTCATTCTCTTTTCTTCCTCTTCCTTTTGCTGTTGCTCCTTTGCAGATGGAAGCAGCATTGCTATGACTTCTTTGCGTCCCAGCGCTTTCCTTTGACTTTGTTCGGATACTTGAAGACGGAATTTGTCAATGACGCCNAAGTGACTGGCTCGGACATCTTTGTGCCGTATAACAATATCAACGCAGCACTGAGGTTTCACTGCCCCTGCAGCATCCACTACAACGTACTTATTGGGAGACGTACAGAGAAATTTAAATTTTAAAGCGAACTCATAAGGGTTGTACAAGGTTAACACCTGCTTGTGCGTAGAAAGAATATCCGGCATAAATAATAACCTCTGTTGAAAAAACAAAAACTGGAAGGTTCCCTTCCCACTAGCTCTGGGCGCCCGTTTTTTCCTGCTGCCATGGGTCCCAACTTTTTTTGGACAAAGTTTGTCATTATTTAAAAAAACAATTGCCTCATCCAATTTTGTTTGCAAACCAAACCAAGGAAAAAAAAAACAAAAAAAAAAAAAAAAAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTCGCAAAACAACCATTGTTAC