ORFeome > mospd2 ORF2 – XORFeome v1.0

mospd2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mospd2
Gene ID: 957664
Gene Page ID: 957658
ORF Xenbase ID: 17284563

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110926
Original XGC clone length: 1530

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ837679
dbEST ID: 79655381
Trimmed Sequence: ATGGCTGAGGACAAGGAGCAGCAAATTCAAGAGACAAGAAAAAGGTTTACTCAGGAGTATCTGCAAGATAAGGCTGACAAGTATGATTCTCGTGATGTGGACAGACTACAGACCGACGACGCCTTGGTGGAAAACTACCTGATGTGGAGGCACTGTGTAACGGAGGATGCTCTGAAGATGATAGATGAAAGCCTGAAATGGAGGAAAGAAATTGGTGTGAATGACTTGAGTGAATCCACTATTCCTAAGTGGTGTTTTGAGACTGGAGCAACTTATCTGCATGGATACGACAAAGAAGGAAATAAATTGTTGTGGCTCAGGGTAAAGCTCCATGTACGTGATGGTAAAACAAATGAGGACAAGAAAAAGTTTGTGGCATTTTGGTTGGAGCGCTATGCCAGGAGAGAACCAGGAAAGCTGCTAACTGTTGTTTTTGACATGCTTGACTCTGGATTAAGCAATATAGATATGGATTTTGTTCGGTTTGTTATCAACTCTTTTAAGACCTACTACCCCAGATATCTGTCTAAGATGGTAGTCTTTGAAATGCCATGGATATTGAATGCTGCCTTCAAAATTGTGAAAAGTTGGCTTGGTCCAGAGGCTATAAATGTGCTGAAATTTGTGAATAAGAGTCAAGTTCAGGACTACATCAGCATTGAATACTTGCCCCCACACTTGGGGAGGAACTGATCCCTTTCAAGTACAGTTTATCCTCCCATACCCAACGATGAATTTTCAAACGCCGTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGACAAGGAGCAGCAAATTCAAGAGACAAGAAAAAGGTTTACTCAGGAGTATCTGCAAGATAAGGCTGACAAGTATGATTCTCGTGATGTGGACAGACTACAGACCGACGACGCCTTGGTGGAAAACTACCTGATGTGGAGGCACTGTGTAACGGAGGATGCTCTGAAGATGATAGATGAAAGCCTGAAATGGAGGAAAGAAATTGGTGTGAATGACTTGAGTGAATCCACTATTCCTAAGTGGTGTTTTGAGACTGGAGCAACTTATCTGCATGGATACGACAAAGAAGGAAATAAATTGTTGTGGCTCAGGGTAAAGCTCCATGTACGTGATGGTAAAACAAATGAGGACAAGAAAAAGTTTGTGGCATTTTGGTTGGAGCGCTATGCCAGGAGAGAACCAGGAAAGCTGCTAACTGTTGTTTTTGACATGCTTGACTCTGGATTAAGCAATATAGATATGGATTTTGTTCGGTTTGTTATCAACTCTTTTAAGACCTACTACCCCAGATATCTGTCTAAGATGGTAGTCTTTGAAATGCCATGGATATTGAATGCTGCCTTCAAAATTGTGAAAAGTTGGCTTGGTCCAGAGGCTATAAATGTGCTGAAATTTGTGAATAAGAGTCAAGTTCAGGACTACATCAGCATTGAATACTTGCCCCCACACTTGGGGAGGAACTGATCCCTTTCAAGTACAGTTTATCCTCCCATACCCAACGATGAATTTTCAAACGCCGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGACAAGGAGCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837678
dbEST ID: 79655380
Trimmed Sequence: ACAGTCCTGGTGTTTCATCTTATACACTCCTGCAGCAACAATGGCAACCAGAATGGATAATAAGGCGGCTAACATATGCTGAAACCAGATACAGCGTCCAATCCGTGCTTCTAATCTTCTGTTCGTTTCCAACAGCTGATTCAGCTTAAAATGCAAATCGTCACTGTCTGGTATAGTGTGGTTTAAGGTGTTTGATTTCAGGATTAATGACGATGGCTTGCTATTTTCAATAACATGGCATCTTAACCTATGCTCCATAACTTTACTCCTGGGCAGCTCCTTCCAAAACTGTGCAAGTTCTTGTGTGCTGGCACTGGAGGGCTGTTCCATTTCGGCCGCCATTACTAAGAATCTGTCCTGAAGAGAGGCTACAAAGGCTGCGTGCAGAGACACAACAATATCAACCGTCGATCCTGGTTCACAACTACTGTTACTTGGTTTGACTCTGTATTTTTCAGGAGCAGTTGTCCTCACCTTAAATGCCACTGTGTTTTTTGTTACATTACTCAGCACGATGATACATTTTCGCTCCCCACTTTCCTTGGACCCAAAATGCAGCTCTTCTGCTGGACTGATATGCAAGAAAGGCCCTTTAAAAACTGTTGACGCCTTCCTGTTGTTTTTTTGCTTTATATCATTTTTGTCTAAATCCTCCTGTTTAATTTGGTCTTCATTGATGCTCATCTTTTTTGGCACAATTGAATCGACTGAGTCACCGAAATCTGAATCACTCAATTTGCTTTCAGAATCGTCTTCACTTGCTATTGGGACCATTCTTCACACAACGCCTTTTGAAAGTCATCGATCGGGTAATGGAAGGAAAACTGTAACTGAAAGGGAACAGTTTCCTCCCAACTTGTGGTGGGCAAGGAATTCAATGCCCGAAGGTATCCCCAAAATTTAATTCTTAATTCAAAATTTTCAACCAAATTTTAAACCCTCTGGACCAAGCCAACTTTTTCAAAATTTTGAAAGGCAACAATCCATAATCCAGGGGCATTTCAAAAAAAAACAATACAAAAAACAAAAATTCCGGGGGGTAAGGAAGGTCTTAAAAAAAGGTTAATAAAAAAACCAAAAAAAAAAAAACAATATTTTAAAAATGTGCTTTAATCCCCAAAATTTCAGTCCGTGTGCTTAAAAAAAAAAAACAGATTTAGAAAAACCCTTTTCCCTGTGGGTGTTTGTCTGCTCGTTTGGTGTCTTGTAGGCTGGGTCTCGCGCAGAGCACACCGAAAAAATAAGGGCCGC
Full Trace Sequence: TGCCAGGGGAACANGACTATGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGTCCTGGTGTTTCATCTTATACACTCCTGCAGCAACAATGGCAACCAGAATGGATAATAAGGCGGCTAACATATGCTGAAACCAGATACAGCGTCCAATCCGTGCTTCTAATCTTCTGTTCGTTTCCAACAGCTGATTCAGCTTAAAATGCAAATCGTCACTGTCTGGTATAGTGTGGTTTAAGGTGTTTGATTTCAGGATTAATGACGATGGCTTGCTATTTTCAATAACATGGCATCTTAACCTATGCTCCATAACTTTACTCCTGGGCAGCTCCTTCCAAAACTGTGCAAGTTCTTGTGTGCTGGCACTGGAGGGCTGTTCCATTTCGGCCGCCATTACTAAGAATCTGTCCTGAAGAGAGGCTACAAAGGCTGCGTGCAGAGACACAACAATATCAACCGTCGATCCTGGTTCACAACTACTGTTACTTGGTTTGACTCTGTATTTTTCAGGAGCAGTTGTCCTCACCTTAAATGCCACTGTGTTTTTTGTTACATTACTCAGCACGATGATACATTTTCGCTCCCCACTTTCCTTGGACCCAAAATGCAGCTCTTCTGCTGGACTGATATGCAAGAAAGGCCCTTTAAAAACTGTTGACGCCTTCCTGTTGTTTTTTTGCTTTATATCATTTTTGTCTAAATCCTCCTGTTTAATTTGGTCTTCATTGATGCTCATCTTTTTTGGCACAATTGAATCGACTGAGTCACCGAAATCTGAATCACTCAATTTGCTTTCAGAATCGTCTTCACTTGCTATTGGGACCATTCTTCACACAACGCCTTTTGAAAGTCATCGATCGGGTAATGGAAGGAAAACTGTAACTGAAAGGGAACAGTTTCCTCCCAACTTGTGGTGGGCAAGGAATTCAATGCCCGAAGGTATCCCCAAAATTTAATTCTTAATTCAAAATTTTCAACCAAATTTTAAACCCTCTGGACCAAGCCAACTTTTTCAAAATTTTGAAAGGCAACAATCCATAATCCAGGGGCATTTCAAAAAAAAACAATACAAAAAACAAAAATTCCGGGGGGTAAGGAAGGTCTTAAAAAAAGGTTAATAAAAAAACCAAAAAAAAAAAAACAATATTTTAAAAATGTGCTTTAATCCCCAAAATTTCAGTCCGTGTGCTTAAAAAAAAAAAACAGATTTAGAAAAACCCTTTTCCCTGTGGGTGTTTGTCTGCTCGTTTGGTGTCTTGTAGGCTGGGTCTCGCGCAGAGCACACCGAAAAAATAAGGGCCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGTCCTGGTGTTTCATCTT