ORFeome > mpp1 ORF1 – XORFeome v1.0

mpp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mpp1
Gene ID: 6078958
Gene Page ID: 5787648
ORF Xenbase ID: 17284605

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047257
Original XGC clone length: 1383

Human orthology & disease relationships

NCBI Entrez ID: 4354
Ensembl gene IDs: ENSG00000130830
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ824374
dbEST ID: 79642076
Trimmed Sequence: ATGACAATGAAGTTTGAGCGCACAGACAACCCGTTGTGTGACAGTTCCAGTGTGAGGACTGCGCTTTCGGACCTGTATCTGGAAACCCTGCTTCAGAACAGAGGCTCAGCCAAGGGCTCCCAAACCAGTGCCAGCTCTCACACAGAGGAGCTTTACACAAATGGATCTGCAGCTCCAGGAACAGAGGAAAAGAAGAGAGTACGACTTGTACAGTTTGAAAGAGAAACTGAAGAACCTATGGGTATCACTCTCAAGGTGAATTCACAGCAGAGCTGCATAGTCGCTCGCATATTACATGGAGGATTCATTCACAGACAAGGTTCACTTCATGTTGGAGATGAAATTCTGGAAATCAATGGGAAAAGTGTTCGAAATCAGAGTGTGGATCATCTGCAAAGTGTTCTGAAAGAAAGCAAAGGGACTGTTGTTTTAAAAGTGTCACCATCACAGAGCAATCGCAAGCCCCCACTTCAGATGTATGTACGAGCACTGTTTGATTACAACCCTCTCTCTGATGCATTGATACCATGCCGTGAGGCTGGCTTGACCTTTCATACTGGAGATATCCTTCAGATCATAAACAAGGATGATTCCAATTGGTGGCAAGGACGTTTACAGGGGTGAGGGTTCAGCAGGCCTTATCCCTTCTCCAGAACTTCAGGGAGTGGCGCGTGGCAAGTTCCACTACTTCAAATCAGAATCCACAAAGTTGTAGCCCTTTTAGCANGAAGAGGAAATGTAAAGACAAATACCNTGGGCAAGCACAGTTTCATATTTGGACAAGCTGATGTATGGTCCCCCAATGAAGGGAAGTGGGTTTCCCCTAACGACTTTTTACAA
Full Trace Sequence: ATTGATTTTTATATTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAATGAAGTTTGAGCGCACAGACAACCCGTTGTGTGACAGTTCCAGTGTGAGGACTGCGCTTTCGGACCTGTATCTGGAAACCCTGCTTCAGAACAGAGGCTCAGCCAAGGGCTCCCAAACCAGTGCCAGCTCTCACACAGAGGAGCTTTACACAAATGGATCTGCAGCTCCAGGAACAGAGGAAAAGAAGAGAGTACGACTTGTACAGTTTGAAAGAGAAACTGAAGAACCTATGGGTATCACTCTCAAGGTGAATTCACAGCAGAGCTGCATAGTCGCTCGCATATTACATGGAGGATTCATTCACAGACAAGGTTCACTTCATGTTGGAGATGAAATTCTGGAAATCAATGGGAAAAGTGTTCGAAATCAGAGTGTGGATCATCTGCAAAGTGTTCTGAAAGAAAGCAAAGGGACTGTTGTTTTAAAAGTGTCACCATCACAGAGCAATCGCAAGCCCCCACTTCAGATGTATGTACGAGCACTGTTTGATTACAACCCTCTCTCTGATGCATTGATACCATGCCGTGAGGCTGGCTTGACCTTTCATACTGGAGATATCCTTCAGATCATAAACAAGGATGATTCCAATTGGTGGCAAGGACGTTTACAGGGGTGAGGGTTCAGCAGGCCTTATCCCTTCTCCAGAACTTCAGGGAGTGGCGCGTGGCAAGTTCCACTACTTCAAATCAGAATCCACAAAGTTGTAGCCCTTTTAGCANGAAGAGGAAATGTAAAGACAAATACCNTGGGCAAGCACAGTTTCATATTTGGACAAGCTGATGTATGGTCCCCCAATGAAGGGAAGTGGGTTTCCCCTAACGACTTTTTACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAATGAAGTTTGAGCGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ829733
dbEST ID: 79647435
Trimmed Sequence: GTACACCCACGTAACAGGAACCCACTGAGGGGAAGAACAGGCTGCATCAAAAGCTTCCAATAGGTCCTGCACTGTCTGCTCAACTCCATTATTAACCAGAGTCAGGTCAAAATGTTGTGCATATCGGGAACGCAGGACATCTGAGTCTGCACGCAGCTTCTGCAGAGCCTCGGACTCATCTTTGTCTGTGGGTGAAAAAAACACAATGAATGGAGCCAATTCTGCTGTACGAACCATCTTCAGAGTCTGTGGCTCAATATCCAAAATAGCGACTTTCCCATCTTTATGAAGCTCCTTCACAGTCTGGATCTTTGTTCCAAACATATATCCACTAAAGCTTCCGTATTCCAAGAACTCATTTTCTGATATTGCCCGGCTCATTTCCTCTGCTGAAACAAAGTGATAGGAGCCACTCTCCTCCTCTCCACGTTTTGGGGGGCGGGAGGTATATGGTGCTGGGTACACAAATCTTTCTGGATATTTGGCTAATAAAGTATTTTTTATATGACTGCGTCCAACCCCACTTACGCCAATTAGCACAAGGGTCTTTCTTGTAAAAGCTGGTAGAGAAACCACTTCCTCATAGGACACTACATCAAGCTGGTCAAATATTGAACTGTGCTTTGCCAGGTATTTGTCTTTACATTTCTTCTTCTTGCTAAAAGGGCTACAACTTTGTGGATTCTGAATTTGAAGTAGTGGAACTTGGCCACGCGCCACTTCCTGAAATTCCGGGAAGAAAGGAAAAAGGGCCCGGCTGAACCCCTTCCC
Full Trace Sequence: CGTGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTACACCCACGTAACAGGAACCCACTGAGGGGAAGAACAGGCTGCATCAAAAGCTTCCAATAGGTCCTGCACTGTCTGCTCAACTCCATTATTAACCAGAGTCAGGTCAAAATGTTGTGCATATCGGGAACGCAGGACATCTGAGTCTGCACGCAGCTTCTGCAGAGCCTCGGACTCATCTTTGTCTGTGGGTGAAAAAAACACAATGAATGGAGCCAATTCTGCTGTACGAACCATCTTCAGAGTCTGTGGCTCAATATCCAAAATAGCGACTTTCCCATCTTTATGAAGCTCCTTCACAGTCTGGATCTTTGTTCCAAACATATATCCACTAAAGCTTCCGTATTCCAAGAACTCATTTTCTGATATTGCCCGGCTCATTTCCTCTGCTGAAACAAAGTGATAGGAGCCACTCTCCTCCTCTCCACGTTTTGGGGGGCGGGAGGTATATGGTGCTGGGTACACAAATCTTTCTGGATATTTGGCTAATAAAGTATTTTTTATATGACTGCGTCCAACCCCACTTACGCCAATTAGCACAAGGGTCTTTCTTGTAAAAGCTGGTAGAGAAACCACTTCCTCATAGGACACTACATCAAGCTGGTCAAATATTGAACTGTGCTTTGCCAGGTATTTGTCTTTACATTTCTTCTTCTTGCTAAAAGGGCTACAACTTTGTGGATTCTGAATTTGAAGTAGTGGAACTTGGCCACGCGCCACTTCCTGAAATTCCGGGAAGAAAGGAAAAAGGGCCCGGCTGAACCCCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACACCCACGTAACAGGA