ORFeome > mppe1 ORF1 – XORFeome v1.0

mppe1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mppe1
Gene ID: 987931
Gene Page ID: 987927
ORF Xenbase ID: 17284629

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123239
Original XGC clone length: 1218

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ838284
dbEST ID: 79655986
Trimmed Sequence: ATGATGTTCAAACACTTGGTTCCTCTGAGAAATGGCTTCAACAAGGAGAGGACGTCTCGTCTTAAAGCAAGGCTTTTTTTAAGAAAGTGTTATTCAAAGAAAAATACGATGTTCTTTCCCAAGATGCATCTGAAAAGCTGCTGCAGTTATTACAGCCAAGACTCATATTGAGTGGCCATACACACAGTGCCTGTGAAGTGCTCCATCAAGGCAAAATTCCTGAGATCAATGTCCCATCCTTCAGCTGGAGAAACCGCAACAACCCAAGCTTCATCATGGGGAGCATCACAGCAACCAAATATTCTCTTGCAAAGTGTTTCCTCCCAACAGAGAATACGATCATCTATATCTACTGTACGGCAAGTGTGCTGCTCACTGGCTATGTACTGGCTTGTCTGTGGCTTTGTATATGCCAGAGGATTCACTCGGGAAGAAAACAAAAACCAATATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTTCAAACACTTGGTTCCTCTGAGAAATGGCTTCAACAAGGAGAGGACGTCTCGTCTTAAAGCAAGGCTTTTTTTAAGAAAGTGTTATTCAAAGAAAAATACGATGTTCTTTCCCAAGATGCATCTGAAAAGCTGCTGCAGTTATTACAGCCAAGACTCATATTGAGTGGCCATACACACAGTGCCTGTGAAGTGCTCCATCAAGGCAAAATTCCTGAGATCAATGTCCCATCCTTCAGCTGGAGAAACCGCAACAACCCAAGCTTCATCATGGGGAGCATCACAGCAACCAAATATTCTCTTGCAAAGTGTTTCCTCCCAACAGAGAATACGATCATCTATATCTACTGTACGGCAAGTGTGCTGCTCACTGGCTATGTACTGGCTTGTCTGTGGCTTTGTATATGCCAGAGGATTCACTCGGGAAGAAAACAAAAACCAATATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCAAAAAAAAAATAGACAGTGATCTAAAATCTCCCAAAGGTACACGCCCGGGCGGGGTTCTTTCCCTTCGTTCTCCTCCCGGGGGTGGGGGGGGTGTCCTGTTTTGGGGGGGGGGGGGGGCGCCGCTCCCGCGAAAAAAAAAAAAAAAAACCGGGGCGGATAAAAAAAAGAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGACGTGCTGCGGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTTCAAACACTTGGTTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838283
dbEST ID: 79655985
Trimmed Sequence: TATTGGTTTTTGTTTTCTTCCCGAGTGAATCCTCTGGCATATACAAAGCCACAGACAAGCCAGTACATAGCCAGTGAGCAGCACACTTGCCGTACAGTAGATATAGATGATCGTATTCTCTGTTGGGAGGAAACACTTTGCAAGAGAATATTTGGTTGCTGTGATGCTCCCCATGATGAAACTTGGGTTGTTACGGTTTCTCCAGCTGAANGATGGGACACTGATCTCAGGAATTTTGCCTTGATGGAGCACTTCACAGGCACTGTGTGTATGGCCACTCAATATGAGTCTTGGCTGTAATAACTGCAGCAGCTTTTCAGATGCGTCTTGGGAAAGAACATCGTATTTTTCTTTGAATAACACTTTCTTAAAAAAAGCCTTGCTTTAAGACGAGACGTCCTCTCCTTGTTGAAGCCATTTCTCCGAGGAACCAAGTGTTTGAACATCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTGGTTTTTGTTTTCTTCCCGAGTGAATCCTCTGGCATATACAAAGCCACAGACAAGCCAGTACATAGCCAGTGAGCAGCACACTTGCCGTACAGTAGATATAGATGATCGTATTCTCTGTTGGGAGGAAACACTTTGCAAGAGAATATTTGGTTGCTGTGATGCTCCCCATGATGAAACTTGGGTTGTTACGGTTTCTCCAGCTGAANGATGGGACACTGATCTCAGGAATTTTGCCTTGATGGAGCACTTCACAGGCACTGTGTGTATGGCCACTCAATATGAGTCTTGGCTGTAATAACTGCAGCAGCTTTTCAGATGCGTCTTGGGAAAGAACATCGTATTTTTCTTTGAATAACACTTTCTTAAAAAAAGCCTTGCTTTAAGACGAGACGTCCTCTCCTTGTTGAAGCCATTTCTCCGAGGAACCAAGTGTTTGAACATCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTTAAAAAAAGCATTGTTCATCAATTTGTTGCAACGAACAGGTCACTATCAAGTCAAATAAAATCATTATTTAAAAAAAAAAAAATGCTAAATAATCCATCTTTCCCCACTTAAAAAACAGCGGGAGAAAATACTCCCTAACGGCGCAACCCGAGGTGGCCGCTTTGCCTTCACTGGGGAAGTGGGGGGGGGGCCNCCCCCGGGAAAAAAAAAAGATGACGCAAGAGAGTATTTTTATTGTGGTNGNNNGNGGGGCCCCACAAAAAAAAGAAAAAAAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTGGTTTTTGTTTTCTTCCCGA