ORFeome > mras ORF1 – XORFeome v1.0

mras ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mras
Gene ID: 865873
Gene Page ID: 489495
ORF Xenbase ID: 17284689

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054969
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID: 22808
Ensembl gene IDs: ENSG00000158186
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,114500,115150,124900,125800,125853,135300,148700,159900,161800,162210,182290,192605,193100,193520,211900,300436,300558,301000,303600,313900,600652,600996,603278,603622,604370,605027,605249,605361,607785,607841,607907,608354,608355,608751,609307

Library Location

Plate ID: GDExl11003
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839527
dbEST ID: 79657229
Trimmed Sequence: ATGGCCAACAGGGGAAGCTTAAGGGCTAATGGAGCGGGACAGACGAAAATCTGCCAGTTCAAGCTGGTGCTTCTTGGAGATATGGCGGTTGGAAAGTCCAGTCTAGTACTGCGGTTTGTCAAAGGCCAATTTGATGAGTTTCAAGAGACCACCATAGGCGCTGCCTTTTTGGCACAGTCTGTATGTCTAGATGATACAACGGTGAAGTTTGAGATCTGGGACACAGCAGGGCAAGAGCGCTACCACAGCCTTGCACCTATGTACTACAGAGGAGCGCAGGCGGCCATTGTGGTGTTTGATATCACAAAACCGGAGACATTTGACAGGGCGAAGGCTTGGGTGAAGGAGTTACAGAGACAGGCTAGCCCAAATATCGTTATTGCTTTGGCTGGAAATAAATCCGATTTGGCAGAGAAACGGATGGTGGAGTATGAGGAAGCTCAAACTTATGCAGAAGACACTGGACTCTTATTCATGGAAACATCTGCCAAAACCGCCATGAATGTAAATGAGTTGTTTTTAGCAATAGCAAAGAAAATGCCGAAATCCGATGCCCAAAACCCCACGCACGCGGCCCACAACCGAGGTGTAAATGTCCATGGTTCGGAGCAGCAGCCAAGAAGTGGGTGTTGTGGGAACTT
Full Trace Sequence: CGAGGCACCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAACAGGGGAAGCTTAAGGGCTAATGGAGCGGGACAGACGAAAATCTGCCAGTTCAAGCTGGTGCTTCTTGGAGATATGGCGGTTGGAAAGTCCAGTCTAGTACTGCGGTTTGTCAAAGGCCAATTTGATGAGTTTCAAGAGACCACCATAGGCGCTGCCTTTTTGGCACAGTCTGTATGTCTAGATGATACAACGGTGAAGTTTGAGATCTGGGACACAGCAGGGCAAGAGCGCTACCACAGCCTTGCACCTATGTACTACAGAGGAGCGCAGGCGGCCATTGTGGTGTTTGATATCACAAAACCGGAGACATTTGACAGGGCGAAGGCTTGGGTGAAGGAGTTACAGAGACAGGCTAGCCCAAATATCGTTATTGCTTTGGCTGGAAATAAATCCGATTTGGCAGAGAAACGGATGGTGGAGTATGAGGAAGCTCAAACTTATGCAGAAGACACTGGACTCTTATTCATGGAAACATCTGCCAAAACCGCCATGAATGTAAATGAGTTGTTTTTAGCAATAGCAAAGAAAATGCCGAAATCCGATGCCCAAAACCCCACGCACGCGGCCCACAACCGAGGTGTAAATGTCCATGGTTCGGAGCAGCAGCCAAGAAGTGGGTGTTGTGGGAACTTGCCAACTTTCTTGTACAAGTTTGCATTATAAGAAAGCATTGCTTATCATTTTGTTGCACCGAACAGGTACTATCAGTCCAAATAAAATTATTTTTGCCATCCCACCCTAAAAACAAAAAAAAAAAAATAAAAAAAAAAAGGATATAATCTGTTTCCCGGGGCGGCTCTGGCCCGGTCAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAACAGGGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839526
dbEST ID: 79657228
Trimmed Sequence: GTTCCCACAACACCCACTTCTTGGCTGCTGCTCCGAACCATGGACATTTACACCTCGGTTGTGGGCCGCGTGCGTGGGGTTTTGGGCATCGGATTTCGGCATTTTCTTTGCTATTGCTAAAAACAACTCATTTACATTCATGGCGGTTTTGGCAGATGTTTCCATGAATAAGAGTCCAGTGTCTTCTGCATAAGTTTGAGCTTCCTCATACTCCACCATCCGTTTCTCTGCCAAATCGGATTTATTTCCAGCCAAAGCAATAACGATATTTGGGCTAGCCTGTCTCTGTAACTCCTTCACCCAAGCCTTCGCCCTGTCAAATGTCTCCGGTTTTGTGATATCAAACACCACAATGGCCGCCTGCGCTCCTCTGTAGTACATAGGTGCAAGGCTGTGGTAACGCTCTTGCCCTGCTGTGTCCCAGATCTCAAACTTCACCGTTGTATCATCTAAACATACAAACTGTGCCAAAAAGGCAGCGCCTATGGTGGTCTCTTGAAACTCATCAAATTGGCCTTTGACAAACCGCAGTAATAAACTGGACCTTCCAACCGCCATATCTCCAAAAAGCACCAAGCTTGACTGGCAAAATTTCGTCTGTCCCCCTTCCTTTAGCCCTAAACCCTTCCCTGTTGGCCATGGTGGC
Full Trace Sequence: GGCATTCAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCCCACAACACCCACTTCTTGGCTGCTGCTCCGAACCATGGACATTTACACCTCGGTTGTGGGCCGCGTGCGTGGGGTTTTGGGCATCGGATTTCGGCATTTTCTTTGCTATTGCTAAAAACAACTCATTTACATTCATGGCGGTTTTGGCAGATGTTTCCATGAATAAGAGTCCAGTGTCTTCTGCATAAGTTTGAGCTTCCTCATACTCCACCATCCGTTTCTCTGCCAAATCGGATTTATTTCCAGCCAAAGCAATAACGATATTTGGGCTAGCCTGTCTCTGTAACTCCTTCACCCAAGCCTTCGCCCTGTCAAATGTCTCCGGTTTTGTGATATCAAACACCACAATGGCCGCCTGCGCTCCTCTGTAGTACATAGGTGCAAGGCTGTGGTAACGCTCTTGCCCTGCTGTGTCCCAGATCTCAAACTTCACCGTTGTATCATCTAAACATACAAACTGTGCCAAAAAGGCAGCGCCTATGGTGGTCTCTTGAAACTCATCAAATTGGCCTTTGACAAACCGCAGTAATAAACTGGACCTTCCAACCGCCATATCTCCAAAAAGCACCAAGCTTGACTGGCAAAATTTCGTCTGTCCCCCTTCCTTTAGCCCTAAACCCTTCCCTGTTGGCCATGGTGGCCAACTTTTTTGTAACAAATTTGGCCTTATAAAAAAAAAATTGCTCATCAAATTTGATGCAACCAAAAAAGGTCCCTAATCAAAAAAAAAAAAAAAAAAAAAAAATAGCGGACCCCGAGCCTTAAAAAACGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCCCACAACACCCACT