ORFeome > mrpl12 ORF1 – XORFeome v1.0

mrpl12 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mrpl12
Gene ID: 1005189
Gene Page ID: 1005182
ORF Xenbase ID: 17284719

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084828
Original XGC clone length: 573

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ840022
dbEST ID: 79657724
Trimmed Sequence: ATGTTCCCTGTAGCTCGTTGCTGCGTGAAATTTCAGGCCGTGGCCTCAACTGTGCGCCGATTGGAGATATCCACGGTCAGGTTGTTAAGGACCACCAGCGAGTTGAGGAACCTCTCTCCCCTACCGTCCCCACCTCTTGACAATGCGCCAAAGGACTATCCACCCAAAATCCATCAACTGGTTGATCAAATTGCCAGCCTTACTCTGCTGGAGGTTTCTGAGCTGAATGAGTTACTTCGGAGAACCCTGAAGATTCAGGATGTTGGGATGATGCCAATGGGTTCAATGATGCCTGGAGCATCTGCAACACCTTCTCAGGATGCAGAAGAATCAGAAGCTCCAGCAAAGAAGGAGAAGACTAATTTCACTGTTAAACTGACAGAAGTGAATGCTACAGATAAAGTCAAACTAATCAAAGAAGTGAAGAACTGTATTCAAGGGCTGAACCTTGTGCAGGCCAAGAAGCTGGTAGAGGCTCTCCCTCAGGAGATTAAAGCGAATGTTTCCAAAGATGAAGCAGAAAAGATAAAAACTGCACTGGAGGCAGCAGGAGGGAAGGTTGTGCTTGAGTT
Full Trace Sequence: GGAACATTCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCCCTGTAGCTCGTTGCTGCGTGAAATTTCAGGCCGTGGCCTCAACTGTGCGCCGATTGGAGATATCCACGGTCAGGTTGTTAAGGACCACCAGCGAGTTGAGGAACCTCTCTCCCCTACCGTCCCCACCTCTTGACAATGCGCCAAAGGACTATCCACCCAAAATCCATCAACTGGTTGATCAAATTGCCAGCCTTACTCTGCTGGAGGTTTCTGAGCTGAATGAGTTACTTCGGAGAACCCTGAAGATTCAGGATGTTGGGATGATGCCAATGGGTTCAATGATGCCTGGAGCATCTGCAACACCTTCTCAGGATGCAGAAGAATCAGAAGCTCCAGCAAAGAAGGAGAAGACTAATTTCACTGTTAAACTGACAGAAGTGAATGCTACAGATAAAGTCAAACTAATCAAAGAAGTGAAGAACTGTATTCAAGGGCTGAACCTTGTGCAGGCCAAGAAGCTGGTAGAGGCTCTCCCTCAGGAGATTAAAGCGAATGTTTCCAAAGATGAAGCAGAAAAGATAAAAACTGCACTGGAGGCAGCAGGAGGGAAGGTTGTGCTTGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTAATTTCCATCCAGCTGATATCCCCTATAGTGAAAAAAAAAAAAAAAAAAAAAACAATTTTCCTGGCACCTCTGGCCCATGTCCAAGAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCCTGTAGCTCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840021
dbEST ID: 79657723
Trimmed Sequence: CTCAAGCACAACCTTCCCTCCTGCTGCCTCCAGTGCAGTTTTTATCTTTTCTGCTTCATCTTTGGAAACATTCGCTTTAATCTCCTGAGGGAGAGCCTCTACCAGCTTCTTGGCCTGCACAAGGTTCAGCCCTTGAATACAGTTCTTCACTTCTTTGATTAGTTTGACTTTATCTGTAGCATTCACTTCTGTCAGTTTAACAGTGAAATTAGTCTTCTCCTTCTTTGCTGGAGCTTCTGATTCTTCTGCATCCTGAGAAGGTGTTGCAGATGCTCCAGGCATCATTGAACCCATTGGCATCATCCCAACATCCTGAATCTTCAGGGTTCTCCGAAGTAACTCATTCAGCTCAGAAACCTCCNGCAGAGTAAGGCTGGCAATTTGATCAACCAGTTGATGGATTTTGGGTGGATAGTCCTTTGGCGCATTGTCAAGAGGTGGGGACGGTAGGGGAGAGAGGTTCCTCCACTCGCTGGTGGTCCTTAACAACCTGACCGTGGATATCTCCAATCGACGCACAGTTGAAGCCACGGCCTGAAATTCACGCAGCAACCAATCTAAAAAAACATGG
Full Trace Sequence: GGAAAACTGCTATTGACCATGTAATACGACTCACTATAGAGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAGCACAACCTTCCCTCCTGCTGCCTCCAGTGCAGTTTTTATCTTTTCTGCTTCATCTTTGGAAACATTCGCTTTAATCTCCTGAGGGAGAGCCTCTACCAGCTTCTTGGCCTGCACAAGGTTCAGCCCTTGAATACAGTTCTTCACTTCTTTGATTAGTTTGACTTTATCTGTAGCATTCACTTCTGTCAGTTTAACAGTGAAATTAGTCTTCTCCTTCTTTGCTGGAGCTTCTGATTCTTCTGCATCCTGAGAAGGTGTTGCAGATGCTCCAGGCATCATTGAACCCATTGGCATCATCCCAACATCCTGAATCTTCAGGGTTCTCCGAAGTAACTCATTCAGCTCAGAAACCTCCNGCAGAGTAAGGCTGGCAATTTGATCAACCAGTTGATGGATTTTGGGTGGATAGTCCTTTGGCGCATTGTCAAGAGGTGGGGACGGTAGGGGAGAGAGGTTCCTCCACTCGCTGGTGGTCCTTAACAACCTGACCGTGGATATCTCCAATCGACGCACAGTTGAAGCCACGGCCTGAAATTCACGCAGCAACCAATCTAAAAAAACATGGTGCCCACTTTTTTTTACAAAGTTTGCATTATAAAAAAGCATTTGCTCATCAATTTGTTTCCACCTAAAGGGTCGCTATCAATCAAAAATAAACAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAGCACAACCTTCCC