ORFeome > mrpl16 ORF1 – XORFeome v1.0

mrpl16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mrpl16
Gene ID: 5836563
Gene Page ID: 5836489
ORF Xenbase ID: 17284731

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123363
Original XGC clone length: 762

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ837533
dbEST ID: 79655235
Trimmed Sequence: ATGGTGCTGATGCTTTCGAACAGGGCAAATGTGGCTGGTCGCCTCTTTTTATCAGGTTGTTTGGAAAATACACACAGAGCTGTCACAGTTGGTCTGAGAACATTTGATATTCCCCCTGATTACAGTGGTGTTAGTATAAGGGACAAACCCAAACTGCGCTTTGTAAACAAGGTTCCTGATCTTGTTAAGGTAAATAAAGAACCAAAAAACTTAAAGGATATTCGAGGACCAGCAAAAGAGGGTCAGGAATTTGAGGAGGGTGAATATGGTATTGTAGCTTTGGGTGGTGGTTATTTACATTGGGGACACTATGAGATGATGCGTCTGACATTGAACCGAGCGCTTTCTCCTCGTACAATATTTAGTCGTTGGCTGGTGGCCCCACCTCACAAGCCTGTAACACAAAAAGGTCTTGGCCAGCGTATGGGTGGGGGAGAAGGTGCAGTGGATCATTATGTCACTCCAGTCACAGCGGATCAACTAATTCTTGATTTGGGAGGGGGGTGTGAGTGTGAGTATGAACAGGAATACTGTCCCACCTCAAAGGAAACTAACCGTTCTCCCCACGCTGTGGGCGGGGGGGGCGTAGTGAAGCAAACCATTAGGTATATTAGTGAAAATAAAATAAAAAGGGACGAGCCAATAATAAAGTTCGCCCCCCGGGGGGAAATAGTAAGTTGGTGAAGAAAAAAAAAAAAAGGGGGGGGGGAATTAAAGAAAAGAAAGGGGGGGGGGGGGGGGGGAGGCCAGAACCGGCGGGTGGGCGGAGGGGGGTGGGGGCCCACCTCGGTATTGGGGAGGGAAAA
Full Trace Sequence: GGCGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCTGATGCTTTCGAACAGGGCAAATGTGGCTGGTCGCCTCTTTTTATCAGGTTGTTTGGAAAATACACACAGAGCTGTCACAGTTGGTCTGAGAACATTTGATATTCCCCCTGATTACAGTGGTGTTAGTATAAGGGACAAACCCAAACTGCGCTTTGTAAACAAGGTTCCTGATCTTGTTAAGGTAAATAAAGAACCAAAAAACTTAAAGGATATTCGAGGACCAGCAAAAGAGGGTCAGGAATTTGAGGAGGGTGAATATGGTATTGTAGCTTTGGGTGGTGGTTATTTACATTGGGGACACTATGAGATGATGCGTCTGACATTGAACCGAGCGCTTTCTCCTCGTACAATATTTAGTCGTTGGCTGGTGGCCCCACCTCACAAGCCTGTAACACAAAAAGGTCTTGGCCAGCGTATGGGTGGGGGAGAAGGTGCAGTGGATCATTATGTCACTCCAGTCACAGCGGATCAACTAATTCTTGATTTGGGAGGGGGGTGTGAGTGTGAGTATGAACAGGAATACTGTCCCACCTCAAAGGAAACTAACCGTTCTCCCCACGCTGTGGGCGGGGGGGGCGTAGTGAAGCAAACCATTAGGTATATTAGTGAAAATAAAATAAAAAGGGACGAGCCAATAATAAAGTTCGCCCCCCGGGGGGAAATAGTAAGTTGGTGAAGAAAAAAAAAAAAAGGGGGGGGGGAATTAAAGAAAAGAAAGGGGGGGGGGGGGGGGGGAGGCCAGAACCGGCGGGTGGGCGGAGGGGGGTGGGGGCCCACCTCGGTATTGGGGAGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCTGATGCTTTCG

Sequences - 3ʹ (reverse) EST

Accession: JZ837532
dbEST ID: 79655234
Trimmed Sequence: CACACGCTTAGACAAGCAGCGTTTGCCCCAGTACCTGCCCTTATTTCGAATGTCAAATGCACTTATCCATTTTCTACAGCCCATCATATTTCGTGTTGCTAGACGGCTAAAAGTCCATGGGTTTTGGTTATTTAATTCTCTATCCTCTACTTCTTGGCGTGCTTTTTTTAGAGTTTCTTTGCTTACAGCCTGTGCTGGAAAGGGCAGTTTCTTTGCCACTTGGGACAGTATTGGTTGAACCTCTTGAAACTCACACCGGCCTCCCACCTCAAGAATTAGTTGATCCGCTTTGACTGGAGTGACATAATGATCCACTGCACCTTTTCCACCACCCATACGTTGGCCAAGACCTTTTCGTGTTACAGGCTTGTGAGGTGGGGCCACCAGCCGACGACTAAATATTGTACGAGGAGAAAGCGCTCGGTTCAATGTCAGACACATCATCTCACAGTGTCCCCGATGTAAATAACCACCACCCAAAACTACGATACCATATTCACCCTCCTCAAATTCCTGACCCTCTGTTGCTGGTGGCGCGGTGATCCGTAATTTTTTTTTGTTCTTTTTTTATCTTAACAAAATCAAAAAACATGCTTGACTAAGGGCATTTATGGGTGGGTCCGGGATCCTAACAACAATGTGAATCAAGAGAAAAAAGGGGGGTGCTGGGGACCAGCGGTGAAGGGCTCGGGGTGGGGGTGTTGGGGGGGGCGTTATTAAGAAAAAGCGAACCGCGGAAGGATAGACCAGACTCCCAAAGCGCCACAGCGCCACGGAATTGCG
Full Trace Sequence: CGGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACACGCTTAGACAAGCAGCGTTTGCCCCAGTACCTGCCCTTATTTCGAATGTCAAATGCACTTATCCATTTTCTACAGCCCATCATATTTCGTGTTGCTAGACGGCTAAAAGTCCATGGGTTTTGGTTATTTAATTCTCTATCCTCTACTTCTTGGCGTGCTTTTTTTAGAGTTTCTTTGCTTACAGCCTGTGCTGGAAAGGGCAGTTTCTTTGCCACTTGGGACAGTATTGGTTGAACCTCTTGAAACTCACACCGGCCTCCCACCTCAAGAATTAGTTGATCCGCTTTGACTGGAGTGACATAATGATCCACTGCACCTTTTCCACCACCCATACGTTGGCCAAGACCTTTTCGTGTTACAGGCTTGTGAGGTGGGGCCACCAGCCGACGACTAAATATTGTACGAGGAGAAAGCGCTCGGTTCAATGTCAGACACATCATCTCACAGTGTCCCCGATGTAAATAACCACCACCCAAAACTACGATACCATATTCACCCTCCTCAAATTCCTGACCCTCTGTTGCTGGTGGCGCGGTGATCCGTAATTTTTTTTTGTTCTTTTTTTATCTTAACAAAATCAAAAAACATGCTTGACTAAGGGCATTTATGGGTGGGTCCGGGATCCTAACAACAATGTGAATCAAGAGAAAAAAGGGGGGTGCTGGGGACCAGCGGTGAAGGGCTCGGGGTGGGGGTGTTGGGGGGGGCGTTATTAAGAAAAAGCGAACCGCGGAAGGATAGACCAGACTCCCAAAGCGCCACAGCGCCACGGAATTGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACACGCTTAGACAAGCA