ORFeome > mrpl44 ORF1 – XORFeome v1.0

mrpl44 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mrpl44
Gene ID: 6255805
Gene Page ID: 1000271
ORF Xenbase ID: 17284821

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC054195
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID: 65080
Ensembl gene IDs: ENSG00000135900
Directly associated (OMIM) disease MIM numbers: 615395
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ839305
dbEST ID: 79657007
Trimmed Sequence: ATGGCGTCCCTGCTTCTTGGGCTCCGGTCTCTAGCACTGTCTGGGCCACGCTGGATTCCAGTCCGAGGGAAAAAGCGCTGGTTGCGACCGTATCTTCGGGCCTTGGAGAAAAAACTGGAACTGGCCGGGCCCCCGAAGCCGATTCCAAGGTCTCAGCAGCCAAATTTTGACTATCATGCAGAGGTACTGGCTTTCTCCCAGCGCTTAAATGAGAGTTTCTCGATGCAACTGCTAAAGACTGCATTTGTGAATAAGACCTACGTGATGCAGGAAGAGCAGCAGCGGCAGGAGCTGGGCCTTGACAAGGAGACGGCCATGTTGAACCTGCAGGATAATGAGCAGCTTGCTGGTGTGGGCTCTGAGTTCACTGCTTCATATGTGCAGAAAACTCTGGAGAAGGCCTTCCCCAACCTGCCTCCTGATGGCATCAAATCTCTAGTTGATCACCTTACTAGCCAGGAGGTTGTATGCCATGTTGCTCAGAATCTTGCAGTGGAAGACTTGACGCTCAGCTCTGAGTGTCCTTTGGACCCGCTAACTATTCACAGAACCTTTTTTGCTATTACCGGAGCTTTGCTGCAGAGCAGTGGCACACAGAGAGCTGGTTTGTTTATCAGGGATTTTTTAATCACACAGTTGATTGGGAAGGACCTCTTCGATATATGGTTAATTGCGAACCCCATGTCTTTCCTGTGGCAGAACTGTCCCATAAAACCCTTCTCCTTCTTGAACCCCCGAAAGAACAAGGAAAATTTGAAACCTCCTACCGGTTTCTGCCTGGTTATTTTTTTTTTTGGAATTATTACGTCA
Full Trace Sequence: CGTGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCCTGCTTCTTGGGCTCCGGTCTCTAGCACTGTCTGGGCCACGCTGGATTCCAGTCCGAGGGAAAAAGCGCTGGTTGCGACCGTATCTTCGGGCCTTGGAGAAAAAACTGGAACTGGCCGGGCCCCCGAAGCCGATTCCAAGGTCTCAGCAGCCAAATTTTGACTATCATGCAGAGGTACTGGCTTTCTCCCAGCGCTTAAATGAGAGTTTCTCGATGCAACTGCTAAAGACTGCATTTGTGAATAAGACCTACGTGATGCAGGAAGAGCAGCAGCGGCAGGAGCTGGGCCTTGACAAGGAGACGGCCATGTTGAACCTGCAGGATAATGAGCAGCTTGCTGGTGTGGGCTCTGAGTTCACTGCTTCATATGTGCAGAAAACTCTGGAGAAGGCCTTCCCCAACCTGCCTCCTGATGGCATCAAATCTCTAGTTGATCACCTTACTAGCCAGGAGGTTGTATGCCATGTTGCTCAGAATCTTGCAGTGGAAGACTTGACGCTCAGCTCTGAGTGTCCTTTGGACCCGCTAACTATTCACAGAACCTTTTTTGCTATTACCGGAGCTTTGCTGCAGAGCAGTGGCACACAGAGAGCTGGTTTGTTTATCAGGGATTTTTTAATCACACAGTTGATTGGGAAGGACCTCTTCGATATATGGTTAATTGCGAACCCCATGTCTTTCCTGTGGCAGAACTGTCCCATAAAACCCTTCTCCTTCTTGAACCCCCGAAAGAACAAGGAAAATTTGAAACCTCCTACCGGTTTCTGCCTGGTTATTTTTTTTTTTGGAATTATTACGTCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCCTGCTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839304
dbEST ID: 79657006
Trimmed Sequence: GCTACTGTGTATGGCTTTTTGTTCTATAATCTCCTGAGAGGTTGAAGAATAATTCCATGGCCTCCTGTTTTCTGTAAATCCAAACATCTTTCTCAGAGCCACGCGAGCAGCCTCCTCTTCTGCGGCAGAGACAGACTCACCAGGACCCTCTGCAATCAGTTCTTTATTGCAGTATAATCCAACAAAGTACACAGGCAGAACAGTAGCAGCTCCACATTCCCTAGTCATCCTGGGTTCAGGAAGAGGAAGGTTTCTATGGGACAGCTCTTGCACCAGCAAAGACATGGGGTCTGCAATTAACCATATATCGAAGAGGTCCTTTCCAATCAACTGTGTGATTAAAAAATCCCTGATAAACAAACCAGCTCTCTGTGTGCCACTGCTCTGCAGCAAAGCTCCGGTAATAGCAAAAAAGGTTCTGTGAATAGTTAGCGGGTCCAAAGGACACTCAGAGCTGAGCGTCAAGTCTTCCACTGCAAGATTCTGAGCAACATGGCATACAACCTCCTGGCTAGTAAGGTGATCAACTAGAGATTTGATGCCATCAGGAGGCAGGTTTGGGGAAGGCCTTCTCCAGAGTTTTCTGCACATATGAACCAGTGAACTCAGAGCCCACACCAGCAAGCTGCTCATTATCCTGCAGGTTCAACATGGCCCGTCTCCTTGTCAAGGCCCACCTCCTGGCCGCTTCTGGCTCTTCCCGCCATCCACGTAAGGTCTTAATTCCCCAAAGGCCAGCTCCTTTAACCCGTTTTGCCAC
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTACTGTGTATGGCTTTTTGTTCTATAATCTCCTGAGAGGTTGAAGAATAATTCCATGGCCTCCTGTTTTCTGTAAATCCAAACATCTTTCTCAGAGCCACGCGAGCAGCCTCCTCTTCTGCGGCAGAGACAGACTCACCAGGACCCTCTGCAATCAGTTCTTTATTGCAGTATAATCCAACAAAGTACACAGGCAGAACAGTAGCAGCTCCACATTCCCTAGTCATCCTGGGTTCAGGAAGAGGAAGGTTTCTATGGGACAGCTCTTGCACCAGCAAAGACATGGGGTCTGCAATTAACCATATATCGAAGAGGTCCTTTCCAATCAACTGTGTGATTAAAAAATCCCTGATAAACAAACCAGCTCTCTGTGTGCCACTGCTCTGCAGCAAAGCTCCGGTAATAGCAAAAAAGGTTCTGTGAATAGTTAGCGGGTCCAAAGGACACTCAGAGCTGAGCGTCAAGTCTTCCACTGCAAGATTCTGAGCAACATGGCATACAACCTCCTGGCTAGTAAGGTGATCAACTAGAGATTTGATGCCATCAGGAGGCAGGTTTGGGGAAGGCCTTCTCCAGAGTTTTCTGCACATATGAACCAGTGAACTCAGAGCCCACACCAGCAAGCTGCTCATTATCCTGCAGGTTCAACATGGCCCGTCTCCTTGTCAAGGCCCACCTCCTGGCCGCTTCTGGCTCTTCCCGCCATCCACGTAAGGTCTTAATTCCCCAAAGGCCAGCTCCTTTAACCCGTTTTGCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTACTGTGTATGGCTTTTTGTT