ORFeome > mrpl53 ORF1 – XORFeome v1.0

mrpl53 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mrpl53
Gene ID: 6253601
Gene Page ID: 944652
ORF Xenbase ID: 17284833

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081225
Original XGC clone length: 327

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ839802
dbEST ID: 79657504
Trimmed Sequence: ATGGCTGCTGTCGGTGCTTCGGAGCTGCTGCTAAAGTCAGTGAAGTCCATCGCTGTGCGATTCTGTCCCTTTGAACCCAATGTCCGGCATGTTAGAGAATTTGTGGAAAAAATAAACTCCAAAAAGATCCGATCTACCAACGCAAACTGTGACATTGCTGTAGACATAAGGCATGACCGGAGTGAACCCTGTGTAGATGTTCTATTTGCTGACGGCGAGAGGCTAGTGATAAAAGGCTCCAATGTGACCTCCAAGGAAATGCTATTGGCATTAAATGTAAAATGTGCCTCCAAGGACCAGCAAGCAAAAGACAGTGGCAGAAAGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTCGGTGCTTCGGAGCTGCTGCTAAAGTCAGTGAAGTCCATCGCTGTGCGATTCTGTCCCTTTGAACCCAATGTCCGGCATGTTAGAGAATTTGTGGAAAAAATAAACTCCAAAAAGATCCGATCTACCAACGCAAACTGTGACATTGCTGTAGACATAAGGCATGACCGGAGTGAACCCTGTGTAGATGTTCTATTTGCTGACGGCGAGAGGCTAGTGATAAAAGGCTCCAATGTGACCTCCAAGGAAATGCTATTGGCATTAAATGTAAAATGTGCCTCCAAGGACCAGCAAGCAAAAGACAGTGGCAGAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCNAAATAAAAAAAAAAAAAAAAAAAAATAATATTACAGGGCTCCCCAAACGCCCGGGGAAAAAAAACAAAAATCCCTTCCCACAAAAGGGCCTGGGTGTTCCCCTTGGGTAAGGGAAAAGGGGCCAAAACAGGGAAAAACTGTGGGGGTCTAATAGGGGTTGGGGGAAGGGGGCCCCCCGCGCCAGGGGCCAAAATTGCCAAACCCCGGGGGAGAAAGGCCGGGGGGTTTTTTTTTTTTAAATTTTTTTTTTTTATTTTATTCACACCCCCCCCCCCCCCCCCCACCCGGCCCCCACAACCCCGCGGCGCGGACGGAGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTCGGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839801
dbEST ID: 79657503
Trimmed Sequence: CTTTCTGCCACTGTCTTTTGCTTGCTGGTCCTTGGAGGCACATTTTACATTTAATGCCAATAGCATTTCCTTGGAGGTCACATTGGAGCCTTTTATCACTAGCCTCTCGCCGTCAGCAAATAGAACATCTACACAGGGTTCACTCCGGTCATGCCTTATGTCTACAGCAATGTCACAGTTTGCGTTGGTAGATCGGATCTTTTTGGAGTTTATTTTTTCCACAAATTCTCTAACATGCCGGACATTGGGTTCAAAGGGACAGAATCGCACAGCGATGGACTTCACTGACTTTAGCAGCAGCTCCGAAGCACCGACAGCAGCCATGG
Full Trace Sequence: GTGTAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTCTGCCACTGTCTTTTGCTTGCTGGTCCTTGGAGGCACATTTTACATTTAATGCCAATAGCATTTCCTTGGAGGTCACATTGGAGCCTTTTATCACTAGCCTCTCGCCGTCAGCAAATAGAACATCTACACAGGGTTCACTCCGGTCATGCCTTATGTCTACAGCAATGTCACAGTTTGCGTTGGTAGATCGGATCTTTTTGGAGTTTATTTTTTCCACAAATTCTCTAACATGCCGGACATTGGGTTCAAAGGGACAGAATCGCACAGCGATGGACTTCACTGACTTTAGCAGCAGCTCCGAAGCACCGACAGCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAAAAAAGACATCGATTCACAACTTAGTGACTGAGCTGTTACCCGGCGGCTCTGAAACGTGTATAGAAAAAAAGGACAATGCACCTTGTTATCAACTCGGGGGATGGGGGAAAAGCCCCCGAACAAGGAAAAACCCCAGGTGGCCTGTTACACAGTTTAGAAGCCCGTTCTTTTTGGGCGGTGTTGTGCAAAAACAAAACCACCCCCCCGGGTAAAAAAACACCAAAGCCTCCTCTTTGGTTTGTATTATATTTTTTTTTGGTGATAACACTCCCTCCGCGCAATCACACAGCGCACCCCTCTCCCCCGGCGCGCGCATTGCTATTGTTTGGTGGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCTGCCACTGTCTTTTGCT