ORFeome > mrps12 ORF1 – XORFeome v1.0

mrps12 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mrps12
Gene ID: 6253785
Gene Page ID: 969290
ORF Xenbase ID: 17284851

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054176
Original XGC clone length: 453

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ839184
dbEST ID: 79656886
Trimmed Sequence: ATGTCATCCACTGTGATCAAGAGCTTTGCCTCTACAGCCATCAGATCAGGTTTCATCCCTTTCTCTAGGGTTCTTGCCCAGTGGATGTTCCGTGCCTCCATACCATGCAACTCGCATAGCATGGCCACCCTAAACCAGATGCATCGTGCAGGCAAGCCCAAGCCTGACCCCCCACAATTGGGTCCCACCTTTGGCTGCCCCCAGCTCAAGGGTGTGGTTTTAAAGACCATGATCCGAAAGCCCAAGAAACCAAACTCTGCCAACCGCAAATGTGCTCGTGTCCGACTCAGCAATGGCAAAGAAGTAATTTGCTTTATACCTGGAGAGGGACACAACCTACAGGAACATAACATTGTCTTGGTGGAGGGGGGCCGCACACAGGACCTGCCAGGTGTGAAACTCAAGATTGTCAGGGGCAAATATGACTGTGCACATGTCAAAAAGAAGAAATT
Full Trace Sequence: GGCACTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATCCACTGTGATCAAGAGCTTTGCCTCTACAGCCATCAGATCAGGTTTCATCCCTTTCTCTAGGGTTCTTGCCCAGTGGATGTTCCGTGCCTCCATACCATGCAACTCGCATAGCATGGCCACCCTAAACCAGATGCATCGTGCAGGCAAGCCCAAGCCTGACCCCCCACAATTGGGTCCCACCTTTGGCTGCCCCCAGCTCAAGGGTGTGGTTTTAAAGACCATGATCCGAAAGCCCAAGAAACCAAACTCTGCCAACCGCAAATGTGCTCGTGTCCGACTCAGCAATGGCAAAGAAGTAATTTGCTTTATACCTGGAGAGGGACACAACCTACAGGAACATAACATTGTCTTGGTGGAGGGGGGCCGCACACAGGACCTGCCAGGTGTGAAACTCAAGATTGTCAGGGGCAAATATGACTGTGCACATGTCAAAAAGAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATGGTGAGTCGTATTAAATGGTCTTAGCTGTTTCCTGGCAGCTAAAGAACAGAACTATAATCTATTAATGATACATCATAATAAGAAACCGGCAAAAATAATACACAATACTTCGTTCTTCCCACGGGGGGGGGGGGTCATGCATAATAAAAAAAAAAAAAGGAGAAAAAAAACAAATAGAAAAAAACATCTCCTCTCCCTAAAAAATAAAACAAAAATAGAAAAAAAAGACCCCCCCCGACCAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATCCACTGTGATCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839183
dbEST ID: 79656885
Trimmed Sequence: TTTCTTCTTTTTGACATGTGCACAGTCATATTTGCCCCTGACAATCTTGAGTTTCACACCTGGCAGGTCCTGTGTGCGGCCCCCCTCCACCAAGACAATGTTATGTTCCTGTAGGTTGTGTCCCTCTCCAGGTATAAAGCAAATTACTTCTTTGCCATTGCTGAGTCGGACACGAGCACATTTGCGGTTGGCAGAGTTTGGTTTCTTGGGCTTTCGGATCATGGTCTTTAAAACCACACCCTTGAGCTGGGGGCAGCCAAAGGTGGGACCCAATTGTGGGGGGTCAGGCTTGGGCTTGCCTGCACGATGCATCTGGTTTAGGGTGGCCATGCTATGCGAGTTGCATGGTATGGAGGCACGGAACATCCACTGGGCAAGAACCCTAGAGAAAGGGATGAAACCTGATCTGATGGCTGTAGAGGCAAAGCTCTTGATCACAATGGATGACATGG
Full Trace Sequence: CGAGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTCTTTTTGACATGTGCACAGTCATATTTGCCCCTGACAATCTTGAGTTTCACACCTGGCAGGTCCTGTGTGCGGCCCCCCTCCACCAAGACAATGTTATGTTCCTGTAGGTTGTGTCCCTCTCCAGGTATAAAGCAAATTACTTCTTTGCCATTGCTGAGTCGGACACGAGCACATTTGCGGTTGGCAGAGTTTGGTTTCTTGGGCTTTCGGATCATGGTCTTTAAAACCACACCCTTGAGCTGGGGGCAGCCAAAGGTGGGACCCAATTGTGGGGGGTCAGGCTTGGGCTTGCCTGCACGATGCATCTGGTTTAGGGTGGCCATGCTATGCGAGTTGCATGGTATGGAGGCACGGAACATCCACTGGGCAAGAACCCTAGAGAAAGGGATGAAACCTGATCTGATGGCTGTAGAGGCAAAGCTCTTGATCACAATGGATGACATGGTGCCAACTTTTTTGTACAAAGTTTGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACAAACAGGTCACTATCNATTCAAAATAAATCATTATTTTGGGGCCCGACCTTAAAAACAAGACATTAATTTACATCGCTCTGGAACTGGCATTTACCCAGGCCACCTTCTGACCCGTTCTCTCAAATCTCTCTAATTTTAAAAAAGGGGNGGTAAAAAAAAAAAAAAAAAAAAAAAAGAAACACAACAAANAAAAAAAAAAAAACACGGGGCGCAGCCGATNGGTTNTGNAGTTNATNNTANACGCCCCCCACAGGGGGGGGGGCGGGNAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCTTTTTGACATGTGCACA